Display Settings:

Format

Send to:

Choose Destination
Pr012333497

STS probe UniSTS:105082 for SMAD family member 4 (SMAD4) and 18 more genes

Synopsis

Field NameValues
NameUniSTS:105082
AliasAF010230
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100048076; LOC100053966; LOC100335513; SMAD4; SMAD4; SMAD4; SMAD4; SMAD4; Smad4; Smad4; Smad4; SMAD4; SMAD4; SMAD4More
UniSTS IDUniSTS:105082

Sequences

>Probe|12333497|PRIMERF Forward PCR primer (outermost) (21b)
CTCTCTCAATGGCTTCTGTCC
>Probe|12333497|PRIMERR Reverse PCR primer (outermost) (21b)
TGGTGTTCCATTGCTTACTTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmUniSTS:105082

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID105082
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5506712
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center