Display Settings:

Format

Send to:

Choose Destination
Pr012332442

STS probe HUM0C12C11 for sushi domain containing 1 (SUSD1) and 4 more genes

Synopsis

Field NameValues
NameHUM0C12C11
AliasesRH1357; SHGC-2544
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSUSD1; LOC100584600; SUSD1; SUSD1; SUSD1
UniSTS IDUniSTS:10413

Sequences

>Probe|12332442|PRIMERF Forward PCR primer (outermost) (23b)
ACTGCAAGAGAATCTCTGCAACC
>Probe|12332442|PRIMERR Reverse PCR primer (outermost) (25b)
TTCTAAAGTGCTTGAAACATTTGCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G393777 cr10000SHGC-2544
Homo sapiensradiation hybridGeneMap99-G393675 cr10000SHGC-2544
Homo sapienslinkageRutgers Map9 cmHUM0C12C11

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID10413
Probe Cross-refcontext specific help for: Probe Cross-refGDB:214361; GDB:223799
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center