Display Settings:

Format

Send to:

Choose Destination
Pr012332240

STS probe SHGC-81798 for peroxisomal biogenesis factor 5 like (PEX5L) and 4 more genes

Synopsis

Field NameValues
NameSHGC-81798
AliasRH113023
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPEX5L; PEX5L-AS2; LOC100508508; PEX5L; PEX5L
UniSTS IDUniSTS:103948

Sequences

>Probe|12332240|PRIMERF Forward PCR primer (outermost) (25b)
ATGCTCTCTTGAAAAACGTAAGCTG
>Probe|12332240|PRIMERR Reverse PCR primer (outermost) (23b)
GCATAACAAATTGAGGTGCACAA

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG399934 cr50000SHGC-81798
Homo sapienslinkageRutgers Map3 cmSHGC-81798

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID103948
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center