Display Settings:

Format

Send to:

Choose Destination
Pr012331665

STS probe D11S4548 for homeodomain interacting protein kinase 3 (HIPK3) and 3 more genes

Synopsis

Field NameValues
NameD11S4548
AliasesRH33878; SHGC-3931
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100432428; HIPK3; HIPK3; HIPK3
UniSTS IDUniSTS:10343

Sequences

>Probe|12331665|PRIMERF Forward PCR primer (outermost) (25b)
ACTGACATCTATTCCATACCTTTAC
>Probe|12331665|PRIMERR Reverse PCR primer (outermost) (25b)
TATTGCAGATAAGATTGGAAGCCTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3111579 cr10000SHGC-3931
Homo sapienslinkageRutgers Map11 cmD11S4548

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID10343
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740126
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center