Display Settings:

Format

Send to:

Choose Destination
Pr012331558

STS probe SHGC-81109 for FRAS1 related extracellular matrix 1 (FREM1) and 4 more genes

Synopsis

Field NameValues
NameSHGC-81109
AliasRH112399
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFREM1; FREM1; FREM1; FREM1; FREM1
UniSTS IDUniSTS:103333

Sequences

>Probe|12331558|PRIMERF Forward PCR primer (outermost) (25b)
AAATCTGGGTATACCAGTCAGGTTG
>Probe|12331558|PRIMERR Reverse PCR primer (outermost) (23b)
TGGAAATTGTTGTATTGTGCTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmSHGC-81109

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID103333
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center