Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

Pr010837449

shRNA probe NPC1L1 for NPC1 like intracellular cholesterol transporter 1 (NPC1L1)

Synopsis

Field NameValues
NameNPC1L1
TypeshRNA
Applicationgene silencing
Other applicationsRNAi
Source organism
Source sequence
Target organismHomo sapiens
Target sequenceNM_013389.1 (Homo sapiens)
Target geneNPC1L1

Sequences

>Probe|10837449|SHRNA_SEQUENCE shRNA sequence (62b)
GATCCGCTTCCATGACCAGCATTCTCAAGAGAAATGCTGGTCATGGAAAGCTTTTTTGGAAA
PositionFeature
25..34shrna loop

References

1.

Localization and role of NPC1L1 in cholesterol absorption in human intestine.

Sané AT, Sinnett D, Delvin E, Bendayan M, Marcil V, Ménard D, Beaulieu JF, Levy E.

J Lipid Res. 2006 Oct;47(10):2112-20.

Assay results for this probe

Disruption of NPC1L1 expression using RNA interference (RNAi) in Caco-2 cells.
Together, our data suggest that NPC1L1 contributes to intestinal cholesterol homeostasis and possibly cooperates with SR-BI to mediate cholesterol absorption in humans.
NameMeasurement-1
Probe User Applicationcontext specific help for: Probe User ApplicationRNAi
Probe Applicationcontext specific help for: Probe Applicationgene silencing
RNAi+ phenotypeno significant changes in cell growth, differentiation, and viability; decrease in the cell ability to capture micellar [(14)C]free cholesterol; increase in the activity and mRNA of of HMG-CoA reductase; decrease in mRNA levels of ACAT and SR-BI
Protein suppression, %context specific help for: Protein suppression, %90
mRNA suppression, %context specific help for: mRNA suppression, %87
Successsuccess
Deliverycontext specific help for: Deliverytransfection
Gene origin 1context specific help for: Gene origin 1endogenous
Cell line 1context specific help for: Cell line 1Caco-2
Cell type 1context specific help for: Cell type 1colonic adenocarcinoma
Experiment subject 1context specific help for: Experiment subject 1cell culture
Organism 1context specific help for: Organism 1Homo sapiens

Computational maps for probe

Does not align to any reference set.
Last Run: 14-Dec-2012

Additional Data

Field NameValues
Submission titlecontext specific help for: Submission titleDisruption of NPC1L1 expression using RNA interference (RNAi) in Caco-2 cells.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center