Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

Pr003104146

siRNA probe SP110 for NM_080424.1

Synopsis

Field NameValues
NameSP110
TypesiRNA
Applicationgene silencing
Other applicationsRNAi
Source organism
Source sequence
Other targetsNucleotide:NM_080424.1

Sequences

>Probe|3104146|SIRNA_SENSE siRNA sense sequence (21b)
GCTTCAAACGTGTTGGTGCTT
PositionFeature
20..21sirna overhang [dna]
1..19sense sequence
>Probe|3104146|SIRNA_ANTISENSE siRNA antisense sequence (21b)
GCACCAACACGTTTGAAGCTT
PositionFeature
20..21sirna overhang [dna]
1..19antisense sequence

Assay results for this probe

The ability of hepatitis C virus core to activate RARa was reduced by RNAi elimination of endogenous Sp110b.
NameMeasurement-1
Probe User Applicationcontext specific help for: Probe User ApplicationRNAi
Probe Applicationcontext specific help for: Probe Applicationgene silencing
Assay commentDharmacon Research (CO)
RNAi+ phenotypeSignificant reduction in activation of RARa-mediated transcription.
Protein suppression, %context specific help for: Protein suppression, %90-100
Successsuccess
Treatmentcontext specific help for: TreatmentHCV core
Deliverycontext specific help for: Deliverytransfection
Gene originendogenous
Cell lineHeLa
Cell typecervical adenocarcinoma
Experiment subjectcell culture
OrganismHomo sapiens

Computational maps for probe

Aligns to Gorilla gorilla (1 gene), Homo sapiens (1 gene) and 4 other organisms
Last Run: 15-Dec-2012

Additional Data

Field NameValues
Submission titlecontext specific help for: Submission titleThe ability of hepatitis C virus core to activate RARa was reduced by RNAi elimination of endogenous Sp110b.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center