Display Settings:

Format

Send to:

Choose Destination

Links from Nucleotide

Pr006081594

shRNA probe V2HS_235280 for major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1)

Synopsis

Field NameValues
NameV2HS_235280
TypeshRNA
Applicationgene silencing
Other applicationsRNAi
Source organismHomo sapiens
Source sequenceNM_002123 (Homo sapiens)
Source geneHLA-DQB1
Target organismHomo sapiens
Target sequenceNM_002123 (Homo sapiens)
Target geneHLA-DQB1

Sequences

>Probe|6081594|SHRNA_SEQUENCE shRNA sequence (97b)
TGCTGTTGACAGTGAGCGCGCTCAAGAGAAGCACATGAAATAGTGAAGCCACAGATGTATTTCATGTGCTTCTCTTGAGCATGCCTACTGCCTCGGA
PositionFeature
1..18mir 30 context
19..40sense
41..59mir 30 loop
60..81antisense
82..97mir 30 context

References

1.

Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis.

Cleary MA, Kilian K, Wang Y, Bradshaw J, Cavet G, Ge W, Kulkarni A, Paddison PJ, Chang K, Sheth N, Leproust E, Coffey EM, Burchard J, McCombie WR, Linsley P, Hannon GJ.

Nat Methods. 2004 Dec;1(3):241-8. Epub 2004 Nov 18.

2.

A resource for large-scale RNA-interference-based screens in mammals.

Paddison PJ, Silva JM, Conklin DS, Schlabach M, Li M, Aruleba S, Balija V, O'Shaughnessy A, Gnoj L, Scobie K, Chang K, Westbrook T, Cleary M, Sachidanandam R, McCombie WR, Elledge SJ, Hannon GJ.

Nature. 2004 Mar 25;428(6981):427-31.

Computational maps for probe

Analysis is pending.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center