Display Settings:

Format

Send to:

Choose Destination

Links from Gene

Pr012837307

STS probe RH66057 for immunoglobulin kappa variable 1/OR2-118 (pseudogene) (IGKV1OR2-118)

Synopsis

Field NameValues
NameRH66057
AliasstSG32280
TypeSTS
Application
Source organism
Source sequence
Target geneIGKV1OR2-118
UniSTS IDUniSTS:88727

Sequences

>Probe|12837307|PRIMERF Forward PCR primer (outermost) (21b)
GATGTCTGGGTTTCCTTAGGG
>Probe|12837307|PRIMERR Reverse PCR primer (outermost) (20b)
GGGTGTTCGATTTGCAGAGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID88727
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center