Display Settings:

Format

Send to:

Choose Destination

Links from Gene

Pr010540819

primer set probe 16E7 for transforming protein E7 (E7)

Synopsis

Field NameValues
Name16E7
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Target organismHuman papillomavirus type 16
Target geneE7

Sequences

>Probe|10540819|PRIMERF Forward PCR primer (outermost) 16E7-U (22b)
AAATGACAGCTCAGAGGAGGAG
>Probe|10540819|PRIMERR Reverse PCR primer (outermost) 16E7-L (22b)
GAGTCACACTTGCAACAAAAGG

References

1.

Establishment of human papillomavirus infection requires cell cycle progression.

Pyeon D, Pearce SM, Lank SM, Ahlquist P, Lambert PF.

PLoS Pathog. 2009 Feb;5(2):e1000318. doi: 10.1371/journal.ppat.1000318. Epub 2009 Feb 27.

Computational maps for probe

Aligns to Alphapapillomavirus 9
Last Run: 15-Dec-2012

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center