Display Settings:

Format

Send to:

Choose Destination
Pr012384489

STS probe D8S1556 for BCL2 interacting protein 3 like (BNIP3L) and 7 more genes

Synopsis

Field NameValues
NameD8S1556
TypeSTS
Application
Source organism
Source sequence
Target genesBNIP3L; VEGFD; VEGFD; BNIP3L; BNIP3L; VEGFD; BNIP3L; BNIP3L
UniSTS IDUniSTS:153669

Sequences

>Probe|12384489|PRIMERF Forward PCR primer (outermost) (24b)
TTAACTGAGCCAAAGTGATTATGC
>Probe|12384489|PRIMERR Reverse PCR primer (outermost) (24b)
TTTGTGAGAGCTTTAATGGCACAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:580466
UniSTS IDcontext specific help for: UniSTS ID153669
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center