Display Settings:

Format

Send to:

Choose Destination
Pr010490358

Saccharomyces cerevisiae microarray element probe YOLWTAU1

Synopsis

Field NameValues
NameYOLWTAU1
Typemicroarray element
Applicationgene expression
Source organism
Source sequence
Target organismSaccharomyces cerevisiae

Sequences

>Probe|10490358|PRIMERF Forward PCR primer (outermost) (26b)
AAAGATATCTGTCCCTTCATTAAGAC
>Probe|10490358|PRIMERR Reverse PCR primer (outermost) (26b)
GCACATTCTCTTATTGTTGATAATTG

References

1.

Systematic identification of balanced transposition polymorphisms in Saccharomyces cerevisiae.

Faddah DA, Ganko EW, McCoach C, Pickrell JK, Hanlon SE, Mann FG, Mieczkowska JO, Jones CD, Lieb JD, Vision TJ.

PLoS Genet. 2009 Jun;5(6):e1000502. doi: 10.1371/journal.pgen.1000502. Epub 2009 Jun 5.

Computational maps for probe

Does not align to any reference set.
Last Run: 15-Dec-2012

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center