Display Settings:

Format

Send to:

Choose Destination
Pr009152993

Saccharomyces cerevisiae microarray element probe YML122c#663

Synopsis

Field NameValues
NameYML122c#663
Typemicroarray element
Applicationgene expression
Source organism
Source sequence
Target organismSaccharomyces cerevisiae

Sequences

>Probe|9152993|DNA_MICROARRAY_ELEMENT DNA microarray element (71b)
AGCATTTGCTCGTAAGGGCCCTTTCAACTCATCTAGCGGCTATGAAGAAAATGTTGCCCGGCTGAAAAACA

References

Computational maps for probe

Does not align to any reference set.
Last Run: 14-Dec-2012

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center