Display Settings:

Format

Send to:

Choose Destination
Pr009149294

Saccharomyces cerevisiae microarray element probe YGR226c

Synopsis

Field NameValues
NameYGR226c
Typemicroarray element
Applicationgene expression
Source organism
Source sequence
Target organismSaccharomyces cerevisiae

Sequences

>Probe|9149294|PRIMERF Forward PCR primer (outermost) (20b)
TCGTTTCATCGTTAGTGGCA
PositionFeature
1..20pcr target-specific sequence [dna]
>Probe|9149294|PRIMERR Reverse PCR primer (outermost) (20b)
GAATGAACATGCAAACCTGC
PositionFeature
1..20pcr target-specific sequence [dna]

References

Computational maps for probe

Aligns to Saccharomyces cerevisiae
Last Run: 14-Dec-2012

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center