Display Settings:

Format

Send to:

Choose Destination
Pr010617243

Saccharomyces cerevisiae SSO probe HXT1

Synopsis

Field NameValues
NameHXT1
TypeSSO
Applicationgene expression
Other applicationsTRanscript analysis with aid of Affinity Capture (TRAC) assay
Source organismSaccharomyces cerevisiae
Source sequence
Target organismSaccharomyces cerevisiae

Sequences

>Probe|10617243|ASSAY_SEQUENCE Probe sequence used in assay (33b)
ATGGTCAGGTGGGCATTTGTTAACTTTAGCTAA

References

1.

Transcription of hexose transporters of Saccharomyces cerevisiae is affected by change in oxygen provision.

Rintala E, Wiebe MG, Tamminen A, Ruohonen L, Penttilä M.

BMC Microbiol. 2008 Mar 28;8:53. doi: 10.1186/1471-2180-8-53.

Computational maps for probe

Analysis is pending.

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center