Display Settings:

Format

Send to:

Choose Destination
Pr031892827

Saccharomyces cerevisiae W303 primer set probe ARS504

Synopsis

Field NameValues
NameARS504
Typeprimer set
Applicationgene expression
Other applicationschromatin immunoprecipitation (ChIP); promoter methylation analysis
Source organismSaccharomyces cerevisiae W303
Source sequence
Target organismSaccharomyces cerevisiae W303
Comment for probeGene promoter for forward and reverse primer respectively: ARS504 +933F and ARS504 +1078R.

Sequences

>Probe|31892827|PRIMERF Forward PCR primer (outermost) BL670 (22b)
CTGTCAGAATATGGGGCCGTAG
>Probe|31892827|PRIMERR Reverse PCR primer (outermost) BL671 (20b)
CACCCCGAAGCTGCTTTCAC

References

1.

Xbp1 directs global repression of budding yeast transcription during the transition to quiescence and is important for the longevity and reversibility of the quiescent state.

Miles S, Li L, Davison J, Breeden LL.

PLoS Genet. 2013 Oct;9(10):e1003854. doi: 10.1371/journal.pgen.1003854. Epub 2013 Oct 31.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Target Gene(s)context specific help for: Target Gene(s)ARS504
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center