Display Settings:

Format

Send to:

Choose Destination
Pr032365907

Neurospora crassa primer set probe NCU09119.7

Synopsis

Field NameValues
NameNCU09119.7
Typeprimer set
Applicationgene expression
Source organismNeurospora crassa
Source sequence
Target organismNeurospora crassa

Sequences

>Probe|32365907|PRIMERF Forward PCR primer (outermost) (20b)
TACCAACGCCAAGGACATCG
>Probe|32365907|PRIMERR Reverse PCR primer (outermost) (20b)
GAGTAGTCGCCCTTGAGCTG

References

1.

Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

Cusick KD, Fitzgerald LA, Pirlo RK, Cockrell AL, Petersen ER, Biffinger JC.

PLoS One. 2014 Dec 4;9(12):e112706. doi: 10.1371/journal.pone.0112706. eCollection 2014.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size114
Target Gene(s)context specific help for: Target Gene(s)ATP synthaselyase gamma subunit (asl)
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center