Display Settings:

Format

Send to:

Choose Destination
Pr032245264

primer set probe ITGA4_SBR for integrin subunit alpha 4 (ITGA4)

Synopsis

Field NameValues
NameITGA4_SBR
Typeprimer set
Applicationgene expression
Source organismHomo sapiens
Source sequence
Source geneITGA4
Target organismHomo sapiens
Target geneITGA4

Sequences

>Probe|32245264|PRIMERF Forward PCR primer (outermost) (21b)
TACACACCCTTCCCGAAAACC
>Probe|32245264|PRIMERR Reverse PCR primer (outermost) (21b)
AGAGGTAACATGCCTGGCAGA

References

1.

An integrated genomic approach identifies persistent tumor suppressive effects of transforming growth factor-β in human breast cancer.

Sato M, Kadota M, Tang B, Yang HH, Yang YA, Shan M, Weng J, Welsh MA, Flanders KC, Nagano Y, Michalowski AM, Clifford RJ, Lee MP, Wakefield LM.

Breast Cancer Res. 2014 Jun 2;16(3):R57. doi: 10.1186/bcr3668.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center