Display Settings:

Format

Send to:

Choose Destination
Pr032223204

primer set probe LL37/CAMP18 for cathelicidin antimicrobial peptide (CAMP)

Synopsis

Field NameValues
NameLL37/CAMP18
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneCAMP
Target geneCAMP

Sequences

>Probe|32223204|PRIMERF Forward PCR primer (outermost) (20b)
TCGGATGCTAACCTCTACCG
>Probe|32223204|PRIMERR Reverse PCR primer (outermost) (18b)
ACAGGCTTTGGCGTGTCT

References

1.

The intestinal archaea Methanosphaera stadtmanae and Methanobrevibacter smithii activate human dendritic cells.

Bang C, Weidenbach K, Gutsmann T, Heine H, Schmitz RA.

PLoS One. 2014 Jun 10;9(6):e99411. doi: 10.1371/journal.pone.0099411. eCollection 2014.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center