Display Settings:

Format

Send to:

Choose Destination
Pr032066309

primer set probe CALPAIN2 for calpain 2 (CAPN2)

Synopsis

Field NameValues
NameCALPAIN2
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneCAPN2
Target geneCAPN2

Sequences

>Probe|32066309|PRIMERF Forward PCR primer (outermost) (20b)
GCAGCCATTGCCTCCCTCAC
>Probe|32066309|PRIMERR Reverse PCR primer (outermost) (20b)
ACCTCCACCCACTCGCCGTA

References

1.

Growth arrest specific 2 is up-regulated in chronic myeloid leukemia cells and required for their growth.

Zhou H, Ge Y, Sun L, Ma W, Wu J, Zhang X, Hu X, Eaves CJ, Wu D, Zhao Y.

PLoS One. 2014 Jan 21;9(1):e86195. doi: 10.1371/journal.pone.0086195. eCollection 2014.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size131
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center