Display Settings:

Format

Send to:

Choose Destination
Pr032066031

primer set probe ITGB1 for integrin subunit beta 1 (ITGB1)

Synopsis

Field NameValues
NameITGB1
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneITGB1
Target geneITGB1

Sequences

>Probe|32066031|PRIMERF Forward PCR primer (outermost) (20b)
GGATTCTCCAGAAGGTGGTT
>Probe|32066031|PRIMERR Reverse PCR primer (outermost) (20b)
GGTAAAACAATGCCACCAAG

References

1.

RNA-seq analysis of host and viral gene expression highlights interaction between varicella zoster virus and keratinocyte differentiation.

Jones M, Dry IR, Frampton D, Singh M, Kanda RK, Yee MB, Kellam P, Hollinshead M, Kinchington PR, O'Toole EA, Breuer J.

PLoS Pathog. 2014 Jan 30;10(1):e1003896. doi: 10.1371/journal.ppat.1003896. eCollection 2014 Jan. PLoS Pathog. 2014 Jul;10(7):e1004313.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center