Display Settings:

Format

Send to:

Choose Destination
Pr031889833

primer set probe ALPL for alkaline phosphatase, liver/bone/kidney (ALPL)

Synopsis

Field NameValues
NameALPL
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneALPL
Target geneALPL

Sequences

>Probe|31889833|PRIMERF Forward PCR primer (outermost) (24b)
CCAGGCTGGAGATGGACAAGTTCC
>Probe|31889833|PRIMERR Reverse PCR primer (outermost) (24b)
ATTGGCCTTCACCCCACACAGGTA

References

1.

miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells.

Hsieh JY, Huang TS, Cheng SM, Lin WS, Tsai TN, Lee OK, Wang HW.

Nucleic Acids Res. 2013 Nov;41(21):9753-63. doi: 10.1093/nar/gkt666. Epub 2013 Aug 20.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size119
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center