Display Settings:

Format

Send to:

Choose Destination
Pr031829277

primer set probe for 3-phosphoinositide dependent protein kinase 1 (PDPK1)

Synopsis

Field NameValues
Name
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source genePDPK1
Target genePDPK1

Sequences

>Probe|31829277|PRIMERF Forward PCR primer (outermost) (20b)
TTCGTCCTCCTCCTCACACT
>Probe|31829277|PRIMERR Reverse PCR primer (outermost) (20b)
GCCTCTGGTCGAAGTTCTTG

References

1.

Transcriptional and Non-Transcriptional Functions of PPARβ/δ in Non-Small Cell Lung Cancer.

Genini D, Garcia-Escudero R, Carbone GM, Catapano CV.

PLoS One. 2012;7(9):e46009. doi: 10.1371/journal.pone.0046009. Epub 2012 Sep 25.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center