Display Settings:

Format

Send to:

Choose Destination
Pr031820788

primer set probe GPX3 Exon 5 for glutathione peroxidase 3 (GPX3)

Synopsis

Field NameValues
NameGPX3 Exon 5
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source geneGPX3
Target geneGPX3

Sequences

>Probe|31820788|PRIMERF Forward PCR primer (outermost) (20b)
TCCATGTCAGCCACTCACTC
>Probe|31820788|PRIMERR Reverse PCR primer (outermost) (19b)
GAAGTTGTAGGCCCTGAGA

References

1.

Loss of glutathione peroxidase 3 expression is correlated with epigenetic mechanisms in endometrial adenocarcinoma.

Falck E, Karlsson S, Carlsson J, Helenius G, Karlsson M, Klinga-Levan K.

Cancer Cell Int. 2010 Nov 24;10:46. doi: 10.1186/1475-2867-10-46.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size594
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center