Display Settings:

Format

Send to:

Choose Destination
Pr031818936

primer set probe PTGS1 for prostaglandin-endoperoxide synthase 1 (PTGS1)

Synopsis

Field NameValues
NamePTGS1
Typeprimer set
Applicationgene expression
Source organism
Source sequence
Source genePTGS1
Target genePTGS1

Sequences

>Probe|31818936|PRIMERF Forward PCR primer (outermost) (20b)
CCGGAGTCTCTTGCTCTGGT
>Probe|31818936|PRIMERR Reverse PCR primer (outermost) (19b)
CTGGTGCTGGCATGGATAG

References

1.

Dose-dependent immunomodulation of human dendritic cells by the probiotic Lactobacillus rhamnosus Lcr35.

Evrard B, Coudeyras S, Dosgilbert A, Charbonnel N, Alamé J, Tridon A, Forestier C.

PLoS One. 2011 Apr 18;6(4):e18735. doi: 10.1371/journal.pone.0018735.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
PCR Product Sizecontext specific help for: PCR Product Size124
Validationcontext specific help for: Validationwet lab success

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center