Display Settings:

Format

Send to:

Choose Destination
Pr017049275

shRNA probe TRCN0000298171 for prostaglandin E synthase 2 (PTGES2)

Synopsis

Field NameValues
NameTRCN0000298171
TypeshRNA
Applicationgene silencing
Source organism
Source sequence
Target organismMus musculus
Target genePTGES2
Other targetsNucleotide:NM_025072

Sequences

>Probe|17049275|FULL_SEQUENCE Full sequence of the hairpin (58b)
CCGGCGCAACAACTAAATGACTCCTCTCGAGAGGAGTCATTTAGTTGTTGCGTTTTTG
PositionFeature
5..25sense sequence [rna]
32..52antisense sequence [rna]

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center