PMC

Conditions were as for , except 26 bp DNA was incubated with tau23 at different pH values.

The proline-rich domain and the microtubule-binding domain may bind to the DNA minor groove in the same orientation plane (A). The complex of the tau protein with double-stranded DNA has a beads-on-a-string appearance under the electronic microscope (B). Bar = 100 nm.

Twenty bp DNA (final concentration 2.5 µM) was incubated with tau23, τPro or τMTBD at different quantitative ratios as indicated in the panels (RT, 30 min). Aliquots were taken for analysis by 20% PAGE. The double-stranded polynucleotide is: 5′AACGAGAAGCGCGATCACAT3′/3′TTGCTCTTCGCGCTAGTGTA5′.

Polynucleotides (12 and 13 bp) were incubated with tau protein under the same experimental conditions (A) as described in . 14 bp DNA and tau at different quantitative ratios are as indicated (B).

The aminoacid residues of Lys were modified with formaldehyde (FA), Cys with iodoacetic acid (IAA), Arg with ethanedial (ED), Asp and Glu with 1-ethyl-3-(3-dimethylaminopropyl (EDAP), respectively, as described under . After that, the modified tau protein was incubated with 26 bp DNA as mentioned in , followed by aliquots were taken for EMSA. The ratios of [protein]/[DNA] are as indicated.

Conditions were referred to , except methyl green a major groove binder was used instead of distamycin A. Methyl green at different concentrations was added to the 26 bp DNA-tau23 complex (A). 26 bp DNA in the presence of methyl green at different concentrations was used as a control (B). M represents molecular mass marker.

Conditions were as described in , except 26 bp dsDNA was used with the addition of distamycin A, a minor groove binder (A). The DNA was mixed with tau protein at different quantitative ratios as indicated. Distamycin A at different concentrations (quantitative ratios as indicated) was added to the tau-DNA complex (B). DNA in the presence of distamycin A at different concentrations was used as a control (C). M represents molecular mass marker.

Copper, ascorbate and 1,10-phenanthroline were premixed in 0.1 M NaOAc/HOAc (pH 5.2) buffer; tau at different concentrations was premixed with DNA at 37 °C for 30 min. Samples were incubated with phen-Cu/ascorbate at room temperature for 5 min. Afterwards, H₂O₂ was added to the solution to give a final volume of 1.2 ml. The chemiluminescence produced in the phen-Cu/H₂O₂/ascorbate system was immediately recorded with a computerized high-sensitivity single-photon counter. The voltage in the photomultiplier was kept at 1000 V (** P<0.01).

A 13 bp DNA (A), tau protein (B) and their complexes at different ratios as indicated (C–F) were imaged by tapping-mode AFM. The histograms (a–f) are frequency counts of the AFM data in panels A–F and show the population distribution of sizes of the particles. Panel G shows the change in average size (horizontal diameter) of 13 bp DNA-tau23 complexes at different quantitative ratios. The average size (nm, ordinate) of the particles of DNA in the presence or absence of tau ([tau]/[DNA] = 8/1) is shown (H).

Tau protein and pEGFP-N1 DNA (quantitative ratio, 1/8) were incubated in 20 mM Tris-HCl buffer containing 2 mM MgCl₂ (pH 8.3, RT, 30 min), and then DNase I (0.05 units) was used to hydrolyze DNA (4730 bp, 100 ng) at 37 °C. Aliquots were taken for agarose gel electrophoresis at different time intervals as indicated. Five mM EDTA (final concentration) was employed to stop the enzymic reaction (lanes 15–20). Hydrolyses of DNA alone (lanes 1–6) and DNA in the presence of BSA (lanes 8–13) were carried out as controls.

Double-stranded polynucleotides (100 ng) with different chain lengths (as indicated in each lane and ) were incubated with tau23 at a ratio [protein]/[DNA] of 1/10 in the buffer of 20 mM Tris-HCl (pH 7.2), containing 50 mM NaCl, 0.5 mM DTT, 1 mM MgCl₂ and 0.5 mM EDTA at room temperature for 30 min, and then aliquots were taken for electrophoresis on a nondenaturing 20% polyacrylamide gel (A). The polynucleotides without tau protein were used as controls under the same experimental conditions (B).