PMC

CARMA1–Bcl10–MALT1 complex formation in the mutant DT40 cells. (A) IKK kinase assay was performed with wild-type DT40 cells. (B) For association of CARMA1with Bcl10 or MALT1, DT40 cells expressing Flag-tagged CARMA1 was established as described in . (C) For the interaction of CARMA1 with Bcl10 or MALT1 in IKKβ-deficient (IKKβ^−/−) cells, endogenous CARMA1 was immunoprecipitated and subjected to Western blotting by the indicated antibodies. WCL, whole cell lysate; wt, wild type.

Thr119, Ser578, and Ser668 on CARMA1 are phosphorylated upon BCR stimulation. (A) Cytosolic extracts (from 2 × 10⁷ cells per sample) were immunoprecipitated with anti-Flag mAb and analyzed by Western blotting. The phosphorylated CARMA1 was detected by each phosphospecific antibody (anti-pT119, -pS578, and -pS668). The arrowhead indicates the position of phosphorylated S578 of CARMA1. (B) Phosphorylation status of CARMA1 in wild-type or PKCβ-deficient (PKCβ^−/−) DT40 cells was determined by the same procedures as in A. (C) For in vitro PKCβ kinase assay, purified Flag-tagged CARMA1 protein was used as a substrate. Phosphorylated CARMA1 was analyzed by Western blotting with anti–phospho-S668 antibody. (D) For association of Bcl10 or MALT1 with CARMA1, wild-type and mutated Flag-tagged CARMA1 cDNAs were transfected with pBIG vectors, as described in Materials and methods, into CARMA1^−/− DT40 B cells. Cell lysates (from 3 × 10⁷ cells per sample) were immunoprecipitated by anti-Flag mAb and analyzed by Western blotting using anti-Bcl10 mAb or anti-MALT1 antibody. WCL, whole cell lysate; wt, wild type.

Multiple Ser/Thr residues of CARMA1 are important for BCR-mediated IKK activation. (A) Schematic diagram of various CARMA1 mutants. Arrowheads represent the mutated amino acid indicated as T119A (left). (B) BCR-mediated IKK, ERK, and JNK activation in wild-type and CARMA1-deficient (CARMA1^−/−) DT40 B cells. IKK kinase assay was measured by phosphorylation of GST-IκBα as a substrate and detected by anti–phos-pho-IκBα mAb (left). Phospho-ERK and -JNK were analyzed by Western blotting (middle and right). (C) For functional analysis of CARMA1 mutants, IKK kinase assay was performed as in B. Wild-type and mutated Flag-tagged CARMA1 cDNAs were transfected into CARMA1^−/− DT40 B cells. Induced IKK activity was quantitated with Multi Gauge software (Fujifilm) and represented as fold activation compared with time zero of the wild type. (top) Protein expression of wild-type and mutated CARMA1, detected by Western blotting with anti-Flag mAb (1 × 10⁶ cells per lane). (D) For JNK activation, whole-cell lysates (2 × 10⁶ cells per lane) were analyzed by Western blotting with anti–phospho-JNK antibody. (E) Sequence aliments of the important Ser/Thr residues between chicken, mouse, and human CARMA1. wt, wild type.

Phosphorylation of Ser578 is mediated by IKKβ. (A) The protein expression of IKKβ was analyzed by Western blotting in wild-type or IKKβ-deficient (IKKβ^−/−) DT40 cells. (B) IKK kinase assay in wild-type or IKKβ^−/− cells was performed as in . (C) The phosphorylation status of endogenous CARMA1 in wild-type or IKKβ-deficient (IKKβ^−/−) DT40 cells was determined. Cytosolic extracts from 6 × 10⁷ cells per sample were immunoprecipitated with anti-CARMA1 antibody and analyzed by the indicated phospho-specific antibodies. Induced CARMA1 phosphorylation was quantitated as in . (D) IKK kinase assay in hemagglutinin-tagged wild-type IKKβ or its S176/181A mutant (SSAA) was performed as in . Both wild-type and mutant knock-in (KI) cells were generated to transfect each KI construct into IKKβ^+/− DT40 cells. (E) Phosphorylation of CARMA1 and recruitment of Bcl10 and MALT1 were examined with Flag-tagged CARMA1 transfected into wild-type– or SSAA-KI cells, as described in . Cell lysates (from 3 × 10⁷ cells per sample) were immunoprecipitated by anti-Flag mAb and analyzed by Western blotting using the indicated antibodies. The phosphorylated CARMA1 was quantitated as in . (F) For in vitro IKKα and β kinase assay, purified Flag-tagged CARMA1 was used as a substrate. Phosphorylated CARMA1 was analyzed by Western blotting with anti–phospho-S578 antibody. WCL, whole cell lysate; wt, wild type.

Conditional PDK1 deletion shows normal BCR-mediated IKK activation. (A) The PDK1 genotype was analyzed by PCR using the following primer pairs: X (tgtggcagcagacagggatctaacatggagagtactgcagctgaatca) and Y (cttctgtgaggagcaattggcgtcgacgtgcaaata) for the floxed allele, or Z (agttaggaagcatcatgagatgagcacatgcttacatcttctg) and W (gcacaaacagttactcgtcctatatacgcttcaatatgtactgccg) for the Δ allele. (left) PCR analysis of genomic DNA. After treatment of tamoxifen for 44 h (+), only the Δ allele genome product (3 kbp by using Z and W primers) was detected, and the floxed allele product (1.5 kbp by using X and Y primers) was not amplified. (right) Scheme shows the targeting strategy. The conditional targeting vector was created with PDK1 cDNA from exon 3 to stop codon with polyA sequence, and the Cre recombinase enzyme with a mutated ligand-binding domain of the estrogen receptor (Cre-ER) under control of actin promoter, flanked by two loxP sites. The construct also contained a blasticidine-resistant gene (Bsr) cassette. (B) For analysis of PDK1–conditional knockout DT40 (CKO) cells, cells were treated with (+) or without (−) 500 nM of 4OH-T for 44 h. IKK kinase assay was performed as in , and phospho-Akt, -ERK, and -JNK were analyzed by Western blotting.