LC-MS/MS Confirmed the Apical Tuft GSTT and Detected More Proteins Specific to Apical Tuft

To determine the molecular differences between apical tuft and lateral motile cilia in more detail, we carried out LC-MS/MS. Several proteins specific to the Zn-treated embryos were identified by a comparison with normal embryos. GSTT was confirmed to be apical tuft-specific, although a small amount was detected in cilia from normal embryos, possibly due to 6.3% cilia in the preparation that appeared to be derived from apical tuft at the animal plate (Table​(Table1,1, Fig. 1). Multiple gene IDs (SPU_016269, SPU_021662, SPU_016270, SPU_006495) showed sequence similarity to GSTT. In addition to GSTT, several redox-related proteins were found to be more abundant in the Zn-treated embryos, containing thioredoxin family Trp26 (SPU_020730), thioredoxin peroxidase (SPU_022529), and thioredoxin reductase 3 (SPU_004780).

Intriguingly the most abundant apical tuft-specific protein was vitellogenin (apolipoprotein B; SPU_028683, peptide count = 94; and other gene IDs included, Table​Table1).1). In addition, the apical tufts contained several proteins with sequence similarities to histone species (SPU_022072, 007820, 024343, {"type":"entrez-protein","attrs":{"text":"NP_999719","term_id":"47551079","term_text":"NP_999719"}}NP_999719, Table​Table1).1). Other notable proteins found to be specific to the Zn-treated embryos included a factor regulating the length of the apical tuft, AnkAT-1 [Yaguchi et al., ²⁰¹⁰] (SPU_024961), a protein defective in a patient with Usher syndrome, Usherin [Weston et al., ²⁰⁰⁰], a syndecan-binding protein syntenin (SPU_009549) and fibrocystin (SPU_023486). Two tubulin isotypes, beta 2C and alpha 1C, also appeared specific to the apical tufts (Table​(Table1,1, Supporting Information Table SII).

Conversely, we found several proteins specific to normal embryos (Supporting Information Table SI). Aminotransferase class V-1 was exclusively found in cilia from normal embryos, not in those from Zn-treated embryos. Another type of GST isoform, omega, was shown to be specific to cilia from normal embryos. Other interesting proteins found abundantly or specifically in the normal embryos included the actin and microtubule-binding protein coronin (SPU_000974), a 77-kDa echinoderm microtubule-associated protein (SPU_006911), intraflagellar transport protein (IFT144), cytoplasmic dynein2, and a protein similar to serotonin/octopamine receptor family protein 7 (Supporting Information Table SII).

To obtain information on the motile machinery axonemes, we listed the axonemal proteins and their related proteins that were identified by LC-MS/MS in the cilia of normal and Zn-treated embryos in Table​Table2.2. Major axonemal proteins, such as those of outer and inner dynein arms, radial spokes, central apparatus and other axonemal proteins, were detected in similar quantities between the normal and Zn-treated embryos, suggesting that the apical tuft cilia are potentially motile.

GSTT is Expressed in the Animal Plate of the Normal Embryo

To explore the functions of the apical tuft, we further focused on GSTT, which was abundantly and specifically found in the apical tuft cilia. Because we used Zn-treated embryos to identify apical tuft-specific proteins, it was possible that GSTT was not an intrinsic apical tuft component but was artificially induced by the treatment. To exclude this possibility, we examined the expression pattern of GSTT in normal sea urchin embryos. We isolated and sequenced a 1,327-bp cDNA clone for GSTT from H. pulcherrimus (termed Hp-GSTT) with an open reading frame encoding 219 amino acids, predicting a molecular mass of 25,256 Da and pI 5.84 (Supporting Information Fig. S1). The molecular mass and pI well matched those that could be estimated by SDS-PAGE and 2DE (Fig. 2).

By using the cDNA as a template, we prepared digoxygenin-labeled RNA probes and performed in situ hybridization. GSTT mRNA was faintly and evenly present until the hatched blastula stage but became increased and limited to the animal plate of the mesenchyme blastula, gastrula, and prism larva. In pluteus larva, the signal became strong at the ciliary band as well (Fig. 4A). Embryos animalized by either Zn-treatment or Δ cadherin injection (Logan et al., ¹⁹⁹⁹) showed strong expression of GSTT throughout the entire region of the thickened ectoderm (Fig. 4B).

Open in a separate window

Figure 4

Expression of GSTT gene during the development of sea urchin embryos. (A) Expression patterns by in situ hybridization of several stages of H. pulcherrimus embryos. GSTT mRNA begins to be highly expressed in the animal plate of mesenchyme blastula and then in the ciliary band of pluteus larva. Bar, 50 μm. B, Expression patterns from in situ hybridization are shown for normal (left), Zn-treated (middle) and Δ cadherin (right) embryos. GSTT mRNA was expressed strongly and ubiquitously throughout Zn-treated or cadherin-depleted embryos. Bar, 50 μm.

The open reading frame of GSTT was subcloned into pET vector in frame, and we prepared a fusion protein and immunized mice to obtain a polyclonal antibody against GSTT. Western blotting against the isolated cilia detected a signal at a 25-kDa protein whose signal was weak in normal embryos but intense in Zn-treated embryos (Fig. 5A). We next tried to isolate apical tuft from normal embryos using dillapiol isoxazoline derivative 1 (DID1) [Semenova et al., ²⁰⁰⁸]. Although a part of apical tuft was detached, treatment of embryos with DID1 caused selective loss of lateral motile cilia (Fig. 5B). Following treatment of the embryos with 2X ASW resulted in the isolation of the rest of apical tuft without contamination of lateral motile cilia. Western blotting showed that GSTT was concentrated in apical tuft in the normal embryos (Fig. 5C). The result also showed that GSTT was significantly increased in the cilia from Zn-treated embryos.

Open in a separate window

Figure 5

Immunoblots of ciliary proteins with an anti-GSTT antibody. (A) A strong 25-kDa signal corresponding to GSTT (arrowhead) was observed in the Zn-treated embryos, whereas the signal was quite faint in the ciliary proteins from normal embryos. (B) Selective deciliation of lateral motile cilia by DID1. After the treatment of 24-h embryos with DID1, lateral motile cilia and a part of apical tuft were detached. Dark field images of embryos without (−) or with (+) DID1 treatment are shown. Arrowheads show apical tufts. Asterisks represent embryos of which apical tuft is detached. Bar, 50 μm. (C) Lateral motile cilia and a part of apical tuft were isolated by DID1. The rest of apical tuft was isolated by 2X ASW (2XSW) without contamination of lateral motile cilia. GSTT was significantly detected in 2XSW. An antibody against a light chain of outer arm dynein (LC3) was used as an internal control [Hozumi et al., ²⁰⁰⁶].

Inhibition of GSTT Increases Ciliary Bending in the Apical Tuft

To investigate the functions of GSTT in the apical tuft, we examined the effects of a potent GST inhibitor, bromosulfophthalein (BSP) [Kolobe et al., ²⁰⁰⁴], on sea urchin embryos. Treatment of 24- to 28-h embryos (mesenchyme blastula to early gastrula) with BSP induced remarkable bending of the apical tuft (Fig. 6A). The angle of the apical tuft relative to the anterior-posterior axis was greatly increased by the treatment (Fig. 6B). The shear angle showed a more than two-fold increase along the entire length of the cilium (Fig. 6C). The maximum increase in the shear angle was achieved at 1 μM. The BSP treatment did not significantly affect the beat frequency of lateral motile cilia (Fig. 6D).

Open in a separate window

Figure 6

Bending of apical tuft by a GST inhibitor, bromosulphophthalein (BSP). (A) Phase contrast images of embryonic cilia. Top two panels, normal embryo; bottom two panels, embryo treated with 10 μM BSP. Right panels show magnified image of apical tuft regions. Note the bending of apical tuft cilia in the BSP-treated embryos. Bar, 50 μm. (B) Angles of the cilia of apical tuft relative to the animal-vegetal axis in normal embryos (open bar) and in those treated with 10 μM BSP (closed bar). The angle of each cilium was measured from recorded images. (C) Shear angles at various distances from the base of the cilia. Open circles, control (0 μM BSP); closed triangles, 1 μM BSP; open rhombuses, 5 μM BSP; open squares, 10 μM BSP. Bars represents standard error (SE) (n = 15). (D) Beat frequency of lateral cilia in embryos treated with several concentrations of BSP. Bars: SE. (E) Swimming speed and trajectories of embryos. Multiple images of normal embryos (top) or those treated with 10 μM BSP (bottom) at 0.05 sec intervals are overdrawn by Bohboh software. Bar: 500 μm. (F) Effect of various concentrations of BSP on the swimming velocity of free-swimming embryos. Bars: SE (n = 3).

Ciliary beating is the driving force for larval swimming. To identify the role of GSTT in the control of embryonic swimming behavior, we traced embryonic swimming in a chamber on a glass slide under a stereomicroscope. Both the normal and BSP-treated embryos swam at almost the same speed, with no significant differences in the trajectories (Figs. 6E and ​and66F).

Embryos Treated with BSP Showed Normal Negative Geotactic Behavior

Sea urchin embryos/larvae show negative geotactic behavior at the stages from blastula to pluteus [Mogami et al., ¹⁹⁸⁸]. To determine whether GSTT in the apical tuft is involved in the negative geotactic behavior of embryos, we examined the effect of BSP treatment on the embryonic behavior against gravity. A glass slide with a chamber (∼1-mm-thick) was placed vertically, and early blastula embryos were inserted from an entrance at the bottom (Fig. 7A). Normal embryos started to move toward the top of the chamber, and nearly 90% of the embryos reached the upper part of the chamber in 2 min. BSP-treated embryos similarly exhibited negative geotaxis with an only slight difference from the normal embryos (Fig. 7B).

Open in a separate window

Figure 7

Effect of BSP on the negative geotactic behavior of sea urchin embryos. (A) Sequential images of embryonic movements in a vertically placed chamber. Images from dark-field stereomicroscopy were processed to draw embryos stuck to the wall and background nonembryonic debris. Top, in the absence of BSP; bottom, in the presence of 10 μM BSP. (B) Percentage of embryos that moved into the half top of the chamber against time. Open or closed bar represents embryos in the absence or presence of 10 μM BSP, respectively. Bars: SE (n = 6).

Handling of Sea Urchin Embryos

Japanese sea urchins, H. pulcherrimus, were collected from around the Shimoda Marine Research Center, University of Tsukuba, Research Center for Marine Biology, Tohoku University, and the Marine and Coastal Research Center, Ochanomizu University. The gametes were collected by an intrablastocoelar injection of 0.5 M KCl. After insemination, eggs were transferred to filtered natural seawater (FSW) or FSW containing 0.5 mM ZnSO₄. Embryos were cultured by standard methods with FSW at 15°C. Cilia were isolated from embryos by treatment with 2X ASW to double the salt concentration [Auclair and Siegel, ¹⁹⁶⁶]. Embryos were first removed by a swing-type of centrifuge (TOMY LC122, TOMY, Tokyo, Japan) at 1,800 rpm for 1 min, and the supernatant was further centrifuged at 2,500 rpm for 10 min to remove embryonic debris. Cilia were collected by centrifugation of the resulting supernatant at 10,000 g for 10 min. Successive extraction of ciliary protein was carried out according to Inaba et al. (¹⁹⁸⁸). For isolation of apical tuft from normal embryos, 26-h embryos were treated with 4 μM DD1 [Semenova et al., ²⁰⁰⁸] for 3 h on ice. After collection of detached cilia, which contained both lateral motile cilia and a part of apical tuft, by centrifugation, the embryos were treated with 2X ASW to collect apical tuft.

Proteomics

Ciliary proteins (∼25 μg) from normal and Zn-treated embryos at 24- and 36-h post fertilization, respectively, were separated by 2DE. Protein spots stained by SYPRO RUBY were cut out, digested by trypsin, and subjected to peptide mass finger printing with MALDI-TOF/MS (Bruker Daltonics, Billerica, MA) as described [Nakachi et al., ²⁰¹¹].

For the liquid chromatography-tandem mass spectrometry (LC-MS/MS), ciliary proteins were separated by SDS-PAGE with 9% polyacrylamide in the separating gel. Protein loaded on a lane of SDS-gel was adjusted to 25 μg for each sample. Proteins were visualized by Coomassie Brilliant Blue R-250 and excised to 16 pieces per lane. Each piece of the gel was digested with trypsin for the LC/MS/MS analysis as described [Yamada et al., ²⁰⁰⁹]. The digested peptides were analyzed using a liquid chromatography system (UltiMate® 3000, DIONEX) and MS/MS (LTQ-XL, Thermo Scientific, Rockford, IL).

Raw spectra data were processed using SEQUEST software to extract peak lists. The obtained peak lists were analyzed using the MASCOT program against the S. purpurutus protein database extracted from SpBase (http://www.spbase.org/SpBase/). We loaded the same amount of proteins (25 μg) for each of normal or Zn-treated embryos but did not normalize them by taking a certain ciliary protein as a standard. The quantities of the proteins identified by LC-MS/MS were comparable to the peptide counts, which were compared between cilia from normal and Zn-treated embryos. Proteins with a peptide count over two in either normal or Zn-treated embryos were treated as identified in this study. The quantities (peptide count) of the proteins identified by LC-MS/MS were compared between cilia from normal and Zn-treated embryos.

Isolation of cDNA for GSTT in H. pulcherrimus

A part (660 bp) of the protein-coding region of GSTT cDNA was amplified from an H. pulcherrimus mesenchyme blastula cDNA library by PCR using following primers: GSTT-F1, ATGACAATCCAGCTGTACGTT; GSTT-R1, CTACTTCGCAAGCGAATCTCT. The 5′- and 3′-UTRs were amplified by rapid-amplification of cDNA ends. The sequence of the full-length cDNA was deposited to DDBJ/EMBL/NCBI (Accession number, {"type":"entrez-nucleotide","attrs":{"text":"AB762295","term_id":"419590338","term_text":"AB762295"}}AB762295).

Whole-Mount in situ Hybridization

Whole-mount in situ hybridization was performed as described [Minokawa et al., ²⁰⁰⁴; Yaguchi et al., ²⁰¹⁰]. cDNA containing the protein coding region was reverse-transcribed by T7 polymerase (Takara Bio, Shiga, Japan) with nucleoside triphosphate (NTP) containing digoxygenin-labeled uridine triphosphate (UTP). Embryos were fixed with 4% paraformaldehyde in FSW 4°C overnight. After extensive washing with a MOPS [3-(N-morpholino)propanesulfonic acid] (MOPS) buffer (0.1 M MOPS, pH 7.0, 0.5 M NaCl, 0.1% Tween-20), embryos were further washed with a hybridization buffer [70% formamide, 0.1 M MOPS, pH 7.0, 0.5 M NaCl, 1.0 mg/mL bovine serum albumin (BSA), 0.1% Tween-20]. Prehybridization and hybridization with probes was carried out at 50°C for 3 h and 1 week, respectively.

Antibodies

The protein-coding region of GSTT was subcloned into pET32a vector and transfected into Escherichia coli AD494. Protein expression was induced by 1.0 mM iso-propoly-β-D-thiogalactoside. The purification of fusion proteins and the preparation of polyclonal antibodies in mouse were carried out as described [Padma et al., ²⁰⁰³; Mizuno et al., ²⁰⁰⁹].

Analysis of Ciliary Motility and Embryonic Behavior

The ciliary movements were observed and analyzed as described [Shiba et al., ²⁰⁰²; Yaguchi et al., ²⁰¹⁰]. The embryos were observed under a phase contrast microscope (BX51; Olympus, Tokyo) equipped with a high-speed camera (200 frames per sec, HAS-220; Ditect, Tokyo, Japan). The embryos at 24–30-h postfertilization were immobilized between a slide glass and a coverslip separated by 58-μm-thick mending tape (3M Scotch). Cilia of the apical tuft and those in the lateral region of embryos were observed and analyzed. Individual images of ciliary movements were analyzed with Bohboh software (Bohboh Soft, Tokyo, Japan). We defined the angles of apical tuft cilia as that between the animal-vegetal axis of the embryo and the straight line from the base to the tip of the cilium. We estimated the shear angle as the angle of the tangent to the ciliary shaft measured with respect to the direction of the axis of the ciliary base.

We recorded the swimming behavior of sea urchin embryos with a stereomicroscope (MZ12.5; Leica, Tokyo) equipped with a digital camera (HDR-CX700; Sony, Tokyo). The embryos at 24–30-h postfertilization were kept in seawater in a chamber by a glass slide (1% BSA-coated) and coverslip sandwiched with a 1-mm-thick silicon spacer. The swimming behaviors of embryos in the chamber were observed at room temperature. For the analysis of geotactic behavior and escaping behavior, a chamber or a micro-maze similarly made of silicon spacers as described above was vertically placed. Embryos were inserted by a pipette at a small entrance opened at the base of the spacer. Swimming velocities and rotational direction were analyzed with Bohboh software. The images of embryonic distribution in a chamber were taken from the movie and processed by Photoshop and Bohboh software.

Electron Microscopy

Embryos were fixed in a solution (0.45 M sucrose, 2.5% glutaraldehyde, 0.1 M sodium cacodylate; pH 7.4) at 4°C for 2 h. After three washes with 0.45 M sucrose buffered with 0.1 M sodium cacodylate (pH 7.4), the embryos were postfixed with 1% OsO₄ buffered with 0.1 M sodium cacodylate (pH 7.4) on ice for 2 h. They were then washed with 0.1 M sodium cacodylate (pH 7.4) at 4°C for 10 min, dehydrated through an ethanol series, and embedded in Quetol 812 (Nisshin EM, Tokyo, Japan). The resin was solidified sequentially at 37°C overnight, 45°C for 12 h, and 60°C for 48 h and thin-sectioned with an average thickness of 70 nm. Sections were stained with uranyl acetate and observed under a transmission electron microscope (JEM 1200EX; JEOL, Tokyo, Japan).

The authors thank the staff of the Shimoda Marine Research Center for their technical support and Drs. Janet Chenevert, Gérard Prulière and Christian Sardet, Observatoire Océanologique, Villefranche-sur-Mer, for helpful suggestions in immunohistochemistry. This work was supported in part by Grants-in-aid No. 21112004 for Scientific Research on Innovative Areas, No. 16083203 for Scientific Research on a Priority Area, and No. 22370023 for Scientific Research (B) to K.I. from the Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT).