Skip to main content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
eLife. 2019; 8: e44248.
Published online 2019 Apr 30. doi: 10.7554/eLife.44248
PMCID: PMC6519985
PMID: 31021314

The Cas4-Cas1-Cas2 complex mediates precise prespacer processing during CRISPR adaptation

Ailong Ke, Reviewing Editor and Cynthia Wolberger, Senior Editor
Ailong Ke, Cornell University;

Associated Data

Data Citations
Supplementary Materials
Data Availability Statement

Abstract

CRISPR adaptation immunizes bacteria and archaea against viruses. During adaptation, the Cas1-Cas2 complex integrates fragments of invader DNA as spacers in the CRISPR array. Recently, an additional protein Cas4 has been implicated in selection and processing of prespacer substrates for Cas1-Cas2, although this mechanism remains unclear. We show that Cas4 interacts directly with Cas1-Cas2 forming a Cas4-Cas1-Cas2 complex that captures and processes prespacers prior to integration. Structural analysis of the Cas4-Cas1-Cas2 complex reveals two copies of Cas4 that closely interact with the two integrase active sites of Cas1, suggesting a mechanism for substrate handoff following processing. We also find that the Cas4-Cas1-Cas2 complex processes single-stranded DNA provided in cis or in trans with a double-stranded DNA duplex. Cas4 cleaves precisely upstream of PAM sequences, ensuring the acquisition of functional spacers. Our results explain how Cas4 cleavage coordinates with Cas1-Cas2 integration and defines the exact cleavage sites and specificity of Cas4.

Research organism: Other

eLife digest

Many people have now heard of CRISPR, or CRISPR-Cas9, as a gene editing technology. Yet CRISPR evolved in bacteria to protect them against viral infections. While parts of the CRISPR system are now being widely used, the research community still does not know everything about how the system operates in its natural setting.

In bacteria, CRISPR protects against infection by making lasting records of viruses a cell has encountered. It cuts short sections from the viral DNA and keeps them as a way to fight the virus if it ever returns. The key proteins in collecting and storing the virus DNA are called Cas1, Cas2 and Cas4. Previous work suggests that Cas4 is important for cutting suitable lengths of DNA for storage. Yet, how Cas4, Cas1 and Cas2 work together to select, cut and store DNA is not well studied.

Lee et al. have now used electron microscopy to examine how Cas1, Cas2 and Cas4 cooperate in the CRISPR system. The proteins studied came from bacteria called Bacillus halodurans. The structure revealed direct links between the Cas1 and Cas4 proteins that likely help to ensure these proteins are coordinated correctly to cut and store the DNA sections. Specifically, it showed that two Cas4 proteins interact with the two key active sites of Cas1. The findings also highlight that Cas4 cuts DNA at specific locations to make sure the resulting DNA sections are suitable for CRISPR protection.

The close association between Cas1 and Cas4 could be a critical aspect of the reliability of the CRISPR system in protecting bacteria from viruses. There are more bacteria on Earth than any other living thing. Understanding their biology has wide ranging environmental, health and bioengineering applications. In addition, learning more about the CRISPR system could further expand its potential to drive revolutionary biotechnology tools derived from these bacterial immune systems.

Introduction

Bacteria and archaea use an adaptive immune system composed of clustered regularly interspaced short palindromic repeats (CRISPR) arrays and CRISPR-associated (Cas) proteins to defend against infection (Barrangou et al., 2007; Brouns et al., 2008; Marraffini and Sontheimer, 2008). Within this system, the CRISPR locus is programmed with ‘spacer’ sequences that are derived from foreign DNA and serve as a record of prior infection events (Bolotin et al., 2005; Mojica et al., 2005; Pourcel et al., 2005). The host adapts to an infection event when Cas proteins insert short fragments from the invader DNA as new spacers between repeating sequence elements within the CRISPR locus (reviewed in Jackson et al., 2017). The locus is transcribed and processed into short CRISPR RNAs (crRNAs), which assemble with Cas proteins to form a RNA-guided surveillance complex (reviewed in Hochstrasser and Doudna, 2015; Charpentier et al., 2015). Finally, the surveillance complex recognizes the target bearing complementarity to the crRNA sequence and a Cas nuclease cleaves or degrades the target during the interference stage (reviewed in Marraffini, 2015).

Although the machinery and mechanisms involved in CRISPR interference are extremely diverse (Koonin et al., 2017), the adaptation proteins Cas1 and Cas2 are conserved among most CRISPR systems, suggesting a common molecular mechanism for acquiring spacers. Cas1 and Cas2 form a heterohexameric complex that catalyzes spacer integration via two transesterification reactions mediated by nucleophilic attack of the 3ʹ-hydroxyl on each strand of a double-stranded prespacer substrate at the phosphodiester backbone within the CRISPR array. Integration occurs at the first repeat in the CRISPR array, with one attack occurring between the upstream leader sequence and the repeat and the other occurring on the opposite strand between the repeat and first spacer within the array (Arslan et al., 2014; Nuñez et al., 2015a; Rollie et al., 2015). These reactions result in the insertion of the prespacer between two single-strand repeats, and this gapped intermediate is repaired by host factors (Ivančić-Baće et al., 2015).

In order to form a functional spacer, the adaptation complex must capture and process longer fragments of DNA from the invader containing a flanking sequence called a protospacer adjacent motif (PAM) (Nuñez et al., 2015b; Wang et al., 2015; Xiao et al., 2017). The PAM is an essential motif during target recognition by the surveillance complex and must be present next to the target in order for interference to occur (Deveau et al., 2008; Redding et al., 2015; Sashital et al., 2012; Semenova et al., 2011; Sternberg et al., 2014). However, the PAM is not part of the spacer and must be removed from the prespacer prior to integration through a processing step. In addition, integration must occur in the correct orientation to produce a crRNA that is complementary to the PAM-containing strand of the invader.

In some systems, additional Cas proteins, such as Cas4, are also required during adaptation. Cas4 is widespread in type I, II, and V systems (Hudaiberdiev et al., 2017). In in vivo studies, deletion of cas4 reduced the adaptation efficiency (Li et al., 2014; Liu et al., 2017) and resulted in the acquisition of non-functional spacers from regions that lacked a correct PAM (Almendros et al., 2019; Kieper et al., 2018; Shiimori et al., 2018; Zhang et al., 2019). Some systems have two cas4 genes that work together to define the PAM, length and orientation of spacers, suggesting that the two Cas4 proteins are involved in processing each end of the prespacer and that they may be present during integration (Shiimori et al., 2018). Similarly, in vitro studies have suggested that Cas4 is involved in PAM-dependent prespacer processing (Lee et al., 2018; Rollie et al., 2018). Cas4 endonucleolytically cleaves PAM-containing 3ʹ-single-stranded overhangs that flank double-stranded prespacers (Lee et al., 2018). Importantly, Cas4 cleavage activity is dependent on the presence of Cas1 and Cas2, and Cas4 inhibits premature integration of unprocessed prespacers. These observations suggest that Cas4 associates with the Cas1-Cas2 complex, although direct biochemical and structural evidence for this Cas4-Cas1-Cas2 complex remains elusive (Lee et al., 2018; Plagens et al., 2012).

Here we show that Cas4 forms a complex with Cas1-Cas2 in the presence of dsDNA. Using single-particle negative-stain electron microscopy (EM), we determined the architecture of Bacillus halodurans type I-C Cas1-Cas2 and Cas4-Cas1-Cas2 complexes. Unlike the symmetrical Cas14-Cas22 structure, we observed a mixture of symmetrical (Cas42-Cas14-Cas22) and asymmetrical (Cas41-Cas14-Cas22) complexes, suggesting a structural mechanism for distinguishing between the PAM and non-PAM end of the prespacer following processing. The positioning of Cas4 places it in close proximity to the Cas1 active site, suggesting a mechanism for substrate handoff following prespacer processing. Surprisingly, the Cas4-Cas1-Cas2 complex processes single-strand DNA when an activator duplex DNA is provided in trans. Using this ssDNA cleavage assay, we show that the Cas4-Cas1-Cas2 complex is highly specific for PAM sequences and cleaves precisely upstream of the PAM. In a duplex substrate, the PAM must be positioned within a single-strand region for optimal cleavage, but Cas4 can cleave at various locations within this single-stranded overhang. Collectively, these findings provide the first structural information of the Cas4-Cas1-Cas2 adaptation complex and reveal the precision and specificity of prespacer processing prior to integration.

Results

Formation of the Cas4-Cas1-Cas2 complex

We previously showed that B. halodurans type I-C Cas4 associates tightly with Cas1 but were unable to obtain the Cas4-Cas1-Cas2 complex due to instability of the Cas1-Cas2 complex in this system (Lee et al., 2018). We hypothesized that a CRISPR DNA substrate may help stabilize the complex. To test this possibility, we designed a CRISPR hairpin ‘target’ substrate containing a 10 bp leader, the full 32 bp repeat, and a 5 bp spacer, mimicking the region of the CRISPR at which integration occurs (Figure 1A). We incubated the individually purified Cas1 and Cas2 proteins with hairpin target DNA in equimolar amounts and removed unassociated DNA via ion-exchange chromatography followed by size-exclusion chromatography to remove free Cas proteins. Incubation of individual components with or without the hairpin target led to different elution volumes from a size-exclusion column (Figure 1B). In the absence of the target, Cas1 and Cas2 proteins generated two separate peaks, which correspond to the peaks of each individual component. When Cas1 and Cas2 were incubated with the target DNA, the proteins eluted earlier as a single peak, while unassociated Cas2 eluted at the original elution volume (Figure 1B–C). These data indicate that the Cas1-Cas2 complex from type I-C is stabilized in the presence of dsDNA.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig1.jpg
Complex formation of B. halodurans Cas1-Cas2 or Cas4-Cas1-Cas2 in the presence of CRISPR hairpin target.

(A) Overview of the cas genes and CRISPR locus found in the Bacillus halodurans type I-C system. Spacers are shown as rectangles, repeats are shown as diamonds, each cas gene is shown as an arrow and gene products involved in adaptation or interference are indicated. The CRISPR hairpin target used for this study contains a 10 bp leader (L, green), the full 32 bp repeat (R, black), and a 5 bp spacer (S, purple). (B) Size-exclusion chromatography (SEC) of various combinations of Cas1, Cas2, Cas4 and target DNA. (C) Coomassie-blue stained SDS-PAGE gel of proteins present in the earliest eluting peak fractions of SEC following complex formation. (D) SYBR Gold stained 10% PAGE gel of DNA present in the earliest eluting peak fractions of SEC following complex formation. (E) Representative 2D class average of the Cas1-Cas2 complex. (F) Representative 2D class average of the Cas4-Cas1-Cas2 complex. Extra density corresponding to Cas4 is indicated by arrows.

Figure 1—figure supplement 1.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig1-figsupp1.jpg
Analysis of Cas4-Cas1-Cas2 formation.

(A) Coomassie-blue stained SDS/PAGE gel of the fractions eluted from the size exclusion column when purifying the complex of Cas4-Cas1-Cas2 with the target DNA. The chromatogram is shown below to indicate where fractions eluted off the column.

Figure 1—figure supplement 2.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig1-figsupp2.jpg
Formation of the Cas4-Cas1-Cas2 complex in the presence of prespacer DNA.

(A) Superdex 75 size exclusion chromatograms (SEC) for samples in which Cas4, Cas1 and Cas2 were incubated with either prespacer (24 bp duplex with 15-nt single-strand overhangs) or the CRISPR hairpin target (Figure 1A, gray solid line, the same trace is shown in Figure 1B). The prespacer alone was also run for reference, and the resulting chromatogram is shown as a dashed line. An additional peak observed in the Cas4 +Cas1+Cas2+prespacer chromatogram is due to excess DNA that was used during complex formation. (B) Coomassie-blue stained SDS-PAGE gel of proteins present in the earliest eluted peak fraction of Cas4+Cas1+Cas2+prespacer. (C) SYBR Gold stained 4–20% PAGE gel of DNA present in the peak fraction of Cas4+Cas1+Cas2+prespacer. The DNA lane is a prespacer sample prepared at the same concentration as the estimated amount of DNA in the peak fraction. The similarity in the two bands indicates that the expected concentration of DNA is present in the complex.

Next, we attempted to reconstitute the putative Cas4-Cas1-Cas2 complex in the presence of the CRISPR hairpin target (Figure 1A). Following incubation of equimolar amounts of each component, Cas4, Cas1 and Cas2 eluted in a single peak from the size-exclusion column (Figure 1—figure supplement 1), with an earlier elution volume than the Cas1-Cas2-target sample (Figure 1B–C). In addition, we observed two peaks with the approximate elution volumes of free Cas1 and Cas2 (Figure 1—figure supplement 1). Both Cas1-Cas2 and Cas4-Cas1-Cas2 complexes contained the hairpin target DNA (Figure 1D). Together, these data suggest that the proteins directly interact with the hairpin target, and the formation of the higher-order complex is also stabilized by the presence of dsDNA substrates.

Architecture of the Cas4-Cas1-Cas2 complex

To characterize the molecular architecture of the complexes, we next performed single-particle electron microscopy (EM) of negatively stained Cas1-Cas2 or Cas4-Cas1-Cas2 complexes bound to the target. Raw micrographs and two-dimensional (2D) class averages revealed particles with fairly homogenous size and symmetrical architecture consistent with the known structure of the Cas1-Cas2 complex (Nuñez et al., 2014; Nuñez et al., 2015b; Wang et al., 2015; Xiao et al., 2017) (Figure 2—figure supplement 1A–B). Some 2D class averages for the Cas4-Cas1-Cas2 complex contained clear additional density, suggesting the presence of ordered Cas4 within the complex (Figure 1E–F).

For the Cas1-Cas2 complex, we determined a 22 Å three-dimensional (3D) reconstruction (Figure 2A). The EM density revealed clear C2 symmetry, which was enforced during the final 3D refinement (Figure 2—figure supplement 2A). Segmentation of the density revealed three clear domains, corresponding to two Cas1 dimers sandwiching a Cas2 dimer (Figure 2A). We fit the B. halodurans Cas2 structure and a structural model of B. halodurans Cas1 (see Materials and methods) to the segmented densities. The structural models fit well, and the overall architecture of the complex was similar to that of the crystal structure of the type II-A Cas1-Cas2-prespacer complex from Enterococcus faecalis (Figure 2—figure supplement 3A,B). In contrast, the E. coli type I-E Cas1-Cas2-prespacer complex (Figure 2—figure supplement 3C) did not fit well in the Cas1-Cas2 density, revealing that the architecture of type I-C Cas1-Cas2 may be more similar to type II-A than to another type I system (Nuñez et al., 2015b; Xiao et al., 2017).

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2.jpg
Architecture of Cas1-Cas2 and Cas4-Cas1-Cas2 complexes formed in the presence of CRISPR hairpin target DNA.

(A) Segmented density for Cas1-Cas2 reconstruction. Two copies of a structural model of BhCas1 dimer (see Materials and methods) were fit in the two assigned Cas1 densities (blue, purple). The crystal structure of BhCas2 (PDB 4ES3) was used for fitting to density assigned to Cas2 (tan) (Nam et al., 2012). (B–C) Segmented density for (B) symmetrical and (C) asymmetrical reconstructions of Cas4-Cas1-Cas2. BhCas1 and BhCas2 structural models are fit to segments and colored as in (A). Two copies of a structural model of BhCas4 are fit into assigned Cas4 densities in (B) (orange, gold). One copy of BhCas4 structural model is fit into assigned Cas4 density in (C) (orange).

Figure 2—figure supplement 1.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp1.jpg
Single particle EM analysis of Cas1-Cas2 and Cas4-Cas1-Cas2.

(A) Representative raw micrographs of Cas1-Cas2 and Cas4-Cas1-Cas (with CRISPR hairpin target or prespacer bound) samples. (B) Representative two-dimensional class averages of Cas1-Cas2 and Cas4-Cas1-Cas2 (with CRISPR hairpin target or prespacer bound) samples. Box size is ~152 × 152 Å. (C) Fourier shell correlation curves for Cas1-Cas2 (black), asymmetrical Cas4-Cas1-Cas2 (red) and symmetrical Cas4-Cas1-Cas2 (blue) bound to CRISPR hairpin target DNA. The resolution using an FSC cutoff of 0.5 is indicated for each structure. (D) Fourier shell correlation curves for asymmetrical Cas4-Cas1-Cas2 (red) and symmetrical Cas4-Cas1-Cas2 (blue) bound to prespacer DNA. The resolution using an FSC cutoff of 0.5 is indicated for each structure. (E) Angular distributions for the final reconstruction for each complex. Cas1-Cas2 and symmetrical Cas4-Cas1-Cas2 complexes were refined with C2 symmetry.

Figure 2—figure supplement 2.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp2.jpg
Three-dimensional classification of Cas1-Cas2 and Cas4-Cas1-Cas2.

The initial model used for 3D classifications is shown at top. The number of particles in each class is shown above each reconstruction. (A) Three-dimensional classes for Cas1-Cas2-target complex. The top row shows the first round of classification into six classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into three classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The 3D class in the dashed box was further refined while enforcing C2 symmetry (bottom row). (B) Three-dimensional classes for Cas4-Cas1-Cas2-target complex. The top row shows the first round of classification into six classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into four classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The asymmetrical 3D class in the dashed box was further refined with C1 symmetry, while the symmetrical 3D classes in the dashed box were further refined while enforcing C2 symmetry (bottom row). (C) Three-dimensional classes for Cas4-Cas1-Cas2-prespacer complex. The top row shows the first round of classification into five classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into three classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The asymmetrical 3D class in the dashed box was further refined with C1 symmetry, while the symmetrical 3D class in the dashed box was further refined while enforcing C2 symmetry (bottom row).

Figure 2—figure supplement 3.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp3.jpg
Modeling of Cas1-Cas2 structures.

(A) Structural model for B. halodurans Cas1 sequence and B. halodurans Cas2 X-ray crystal structure modelled into Cas1-Cas2 density using Fit in Segments package in UCSF Chimera (Pettersen et al., 2004; Pintilie et al., 2010). (B) X-ray crystal structure of E. faecalis Cas1-Cas2 fit to all segments (Xiao et al., 2017). (C) X-ray crystal structure of E. coli Cas1-Cas2 fit to all segments (Nuñez et al., 2015b). Two Cas1 dimers are in blue and purple, Cas2 is in tan.

Figure 2—figure supplement 4.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp4.jpg
Modelling possible orientations of Cas4 within assigned density.

(A) Sequence alignment of P. calidifontis (Pc) and B. halodurans (Bh) Cas4 sequences. The sequence corresponding to the P. calidifontis N-terminal domain is highlighted in red. The sequence included in the predicted BhCas4 structural model is highlighted in blue (B) Crystal structure of PcCas4 (PDB 4R5Q, tan and red, [Lemak et al., 2014]) and structural model of BhCas4 (predicted using Phyre2 server [Kelley et al., 2015], blue). The N-terminal domain of PcCas4, which is not predicted to be present in BhCas4, is highlighted in red. The N- and C-termini of each model are labeled (Pc N-terminus is in red, Bh is in blue, both C-termini are in black). (C) Cartoon depicting four possible orientations of Cas4. Cas1 cartoon is in blue, Cas4 cartoon is in orange. H indicates Cas1 active site, K indicates Cas4 active site, and asterisk indicates Cas4 Fe2S2 cluster. The point-of-view with respect to the orientation shown in Figure 2 is depicted for the cartoon on the left. Cas4 rotates ~180° around either the z-axis or y-axis from one cartoon to the next, as depicted in the axes shown above Cas4. (D–E) Top four fits of Cas4 into segmented density from the (D) symmetrical Cas4-Cas1-Cas2-target complex and (E) asymmetrical Cas4-Cas1-Cas2-target complex. Fits reflect the possible orientations shown in cartoon within same column of (C). The Fe2S2 cluster and active site residues of Cas1 (H234) and Cas4 (K110) are indicated. The distance (Dist.) between alpha carbons of the two active site residues and cross-correlation value (Corr.) for each fit are indicated above each structural model.

Figure 2—figure supplement 5.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp5.jpg
Model of Cas1-Cas2 full-site integration product fit in symmetrical Cas4-Cas1-Cas2-target reconstruction.

The protein subunits of the crystal structure of E. faecalis Cas1-Cas2 bound to full-site intermediate (PDB 5XVP) were docked in the reconstruction (Xiao et al., 2017). Proteins are colored as in Figure 2. The prespacer is shown as a red ladder, the CRISPR repeat is shown as a black ladder, and the repeat flanking regions are shown as gray ladders. The segmented Cas4 density is shown in mesh. The Cas4 density lies along the same surface of Cas1 where the CRISPR is bound in the crystal structure.

Figure 2—figure supplement 6.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig2-figsupp6.jpg
Comparison of Cas4-Cas1-Cas2 complexes formed in the presence of CRISPR hairpin target or prespacer DNA.

All volumes were set to a contour level of 0.2 in UCSF Chimera. The highest-resolution EM density (target-bound symmetrical complex) has the best-defined features out of all four volumes.

For the Cas4-Cas1-Cas2 complex, we determined a 20 Å 3D reconstruction of symmetrical particles enforcing C2 symmetry (Figure 2—figure supplement 2B). The segmented density clearly reveals the base Cas1-Cas2 architecture, along with additional density corresponding to two molecules of Cas4 (Figure 2B). During 3D classification of particles, we observed two classes containing approximately 50% of Cas4-Cas1-Cas2 particles that appeared to contain density for only a single Cas4 molecule (Figure 2—figure supplement 2B). A subset of these particles was refined as a separate 21 Å 3D reconstruction without symmetry enforced, revealing an asymmetrical Cas4-Cas1-Cas2 complex with 1:4:2 stoichiometry (Figure 2C). These particles may represent ternary complexes in a partially dissociated state, or incomplete formation of the 2:4:2 stoichiometry complex due to reduced affinity for Cas4 within the ternary complex.

In both the symmetrical and asymmetrical Cas4-Cas1-Cas2 reconstructions, the Cas4 and Cas1 densities are contiguous but Cas4 appears to be distinct from the Cas2 density (Figure 2B–C). This suggests that Cas4 interacts with Cas1 but not Cas2 within the ternary complex, similar to the tight interaction we have previously observed between Cas4 and Cas1 in the absence of Cas2 (Lee et al., 2018). However, the interaction surface between Cas4-Cas1 appears to be different in the context of the binary and ternary complexes, suggesting that Cas4 and Cas1 may have two alternative modes of interaction.

A high-resolution structure of the BhCas4 sequence is not available, and the closest homolog from Pyrobaculum calidifontis (PDB 4R5Q) contains a long N-terminal domain that is likely not present in the BhCas4 structure (Figure 2—figure supplement 4A). Therefore, for modeling Cas4 into the Cas4-Cas1-Cas2 density, we used a predicted structural model (see Materials and methods) that reflects the putatively more compact BhCas4 structure (Figure 2—figure supplement 4B). Fitting this structural model into the segmented Cas4 density revealed four possible orientations of the protein with respect to Cas1 (Figure 2—figure supplement 4C–E). The segmented density for Cas4 is smaller than the structure and parts of the structure fit into the Cas1 density, suggesting that the segmentation between Cas1 and Cas4 densities was incomplete due to low resolution as has been observed previously (Pintilie et al., 2010). All four orientations position the Cas4 active site with varying degrees of proximity (19–38 Å) to the Cas1 active sites that bind the 3ʹ-OH end of the prespacer in structures of Cas1-Cas2-prespacer (Figure 2—figure supplement 4D–E). These active sites act as integrases for the two steps of integration. The proximity between Cas4 and the Cas1 active site suggests that the product of Cas4 cleavage could transit to the integrase active sites following cleavage.

The Cas1-Cas2 and Cas4-Cas1-Cas2 EM volumes did not contain any obvious cylindrical density corresponding to the hairpin target DNA, consistent with prior observations that DNA is not readily observable by negative-stain single-particle EM (Hochstrasser et al., 2014; Nogales and Scheres, 2015). We also note that the Cas4 density lies along the same surface of Cas1 that is expected to interact with elements within the CRISPR array during half-site and full-site integration, based on crystal structures of these intermediates (Figure 2—figure supplement 5). This suggests that the CRISPR hairpin target is either not present in the complex, or that it is bound in an alternate location. The observation that DNA co-elutes with the complex from the size-exclusion column disfavors the former possibility (Figure 1D). Notably, in the highest-resolution symmetrical Cas4-Cas1-Cas2 reconstruction, we observe additional density along the prespacer-binding surface of Cas2, but not the repeat-binding surface (Figure 2—figure supplement 5 middle). Although we cannot definitively define this density as DNA, this observation suggests the DNA may be bound on the prespacer side of the complex and that the CRISPR target in our complex is not bound along the same surface as in prior crystal structures. Together, these observations suggest that Cas4 binding may be mutually exclusive with CRISPR binding along the repeat-binding surface, and that Cas4 may dissociate prior to integration.

Formation of the Cas4-Cas1-Cas2 complex with prespacer substrate

Although we hypothesized that the CRISPR hairpin target would stabilize the Cas1-Cas2 complex by binding along the repeat-binding surface, our structural studies of complexes formed in the presence of the hairpin target suggest this is not the case. Notably, the prespacer-binding surface of Cas2 interacts with DNA through non-specific backbone contacts (Nuñez et al., 2015b; Wang et al., 2015; Xiao et al., 2017), and no structure of Cas1-Cas2 bound to CRISPR DNA alone has been previously reported. This could suggest that any dsDNA, including the CRISPR target, may preferentially bind along the prespacer-binding surface and that other DNA substrates binding in that location could promote stable complex formation. We therefore attempted to form the Cas4-Cas1-Cas2 complex using a prespacer substrate containing a 24 bp duplex with 15-nt 3ʹ overhangs containing 5ʹ-GAA-3ʹ PAM sequences, which we previously showed is processed by Cas4 in the presence of Cas1 and Cas2 (Lee et al., 2018). Using a modified protocol (see Materials and methods), we were able to successfully purify a peak containing Cas4, Cas1, Cas2, and prespacer DNA from a size-exclusion column (Figure 1—figure supplement 2). The peak eluted slightly later than the Cas4-Cas1-Cas2-target complex, likely due to the smaller size of the DNA substrate (Figure 1—figure supplement 2A). As with the Cas4-Cas1-Cas2-target complex, all three proteins and DNA were present in the peak fractions (Figure 1—figure supplement 2B–C).

To determine whether the prespacer complex has a similar architecture to the complex bound to the CRISPR hairpin target, we performed negative stain EM analysis of Cas4-Cas1-Cas2-prespacer (Figure 2—figure supplements 1, ,22 and and6).6). The 2D class averages revealed fewer symmetrical classes (Figure 2—figure supplement 1B), and 3D classification revealed a smaller proportion of particles containing two copies of Cas4 relative to particles containing one or no copies of Cas4 (Figure 2—figure supplement 2C). These data suggest that Cas4 is less stably bound in the Cas4-Cas1-Cas2-prespacer complex than in a complex containing a longer dsDNA. Both EM densities were at a lower resolution than the complexes solved using the hairpin target (symmetrical EM density 22 Å, asymmetrical EM density 24 Å). Although features are less well-defined for these lower resolution densities, the overall architecture is similar between the complexes containing the two different DNA substrates (Figure 2—figure supplement 6), indicating that complex formation occurs similarly regardless of the type of DNA substrate.

Cas4 is activated for ssDNA processing in the presence of dsDNA

The observation that the presence of dsDNA substrates stabilized the Cas4-Cas1-Cas2 complex prompted us to hypothesize that binding to the CRISPR DNA may enhance processing activity by stimulating complex formation. To test this hypothesis, we analyzed cleavage of the prespacer substrate containing a 24 bp duplex with 15-nt 3ʹ overhangs containing 5ʹ-GAA-3ʹ PAM sequences, in the absence or presence of CRISPR DNA (Figure 3A). In addition, we tested cleavage of a single 39-nt strand of this substrate (Figure 3A). Interestingly, for the ssDNA substrate, we observed cleavage product in the presence of the CRISPR DNA, while the DNA remained uncleaved in the absence of the CRISPR DNA or Cas4 (Figure 3B). However, we observed similar amounts of cleavage for duplex prespacers with and without the CRISPR, suggesting that the presence of the CRISPR DNA only enhances cleavage of the ssDNA substrate (Figure 3B). Importantly, we previously showed that cleavage of the duplex prespacer is dependent on having a PAM present in the single-stranded overhang, indicating that cleavage occurs in a PAM-dependent manner (Lee et al., 2018). Consistently, both the ssDNA substrate and the duplex substrate produced the same length product, suggesting they were cleaved at the PAM site located within the 3ʹ-overhang of the duplex substrate. These data suggest that Cas4-Cas1-Cas2 can cleave PAM sites in ssDNA when a CRISPR DNA is provided in trans, and that the dsDNA region present within the duplex prespacer is sufficient to stimulate complex formation.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig3.jpg
Single-stranded DNA processing by the Cas4-Cas1-Cas2 complex.

(A) Schematic of prespacer cleavage assay for (B). L indicates leader, R indicates repeat, S indicates spacer in the CRISPR DNA substrate. Radiolabel is indicated with a star. (B) Prespacer processing assay using ssDNA or duplex prespacer in the absence or presence of CRISPR DNA. Black arrow indicates the cleavage product. Red arrow indicates integration products following processing. (C) Schematic of cleavage assay using 25 nt single-stranded substrates provided in cis or in trans with a 25 bp duplex. (D) Cleavage assay using cis dsDNA or 25-nt ssDNA with titration of 25 bp duplex provided in trans.

Figure 3—figure supplement 1.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig3-figsupp1.jpg
Integration of unprocessed and processed prespacers.

(A) Schematic of integration into the mini-CRISPR array. L – leader, R – repeat, S – spacer, P – processed prespacer following integration, U – unprocessed prespacer following integration. (B) Analysis of processing and integration products in the absence or presence of CRISPR DNA. The same gel is shown in Figure 3B. In this image, the contrast was increased to see the unprocessed integration products in the absence of Cas4.

We previously observed that Cas4 cleavage products can be integrated into mini-CRISPR arrays (Lee et al., 2018) (Figure 3—figure supplement 1A). Notably, although the cleavage product for the duplex prespacer was integrated into the CRISPR (Figure 3B), no integration product was visible for the single-stranded substrate following processing even at increased image contrast (Figure 3—figure supplement 1B). In the absence of Cas4, a small amount of unprocessed integration product was visible when the image contrast was increased for both the ssDNA and duplex prespacer. Together, these results suggest that although Cas1 can integrate ssDNA, optimal integration requires that the single-stranded region be attached to a duplex, which may facilitate handoff of the processed end from Cas4 to the Cas1 active site.

Our results suggest that any dsDNA, not just the CRISPR DNA, may enhance ssDNA cleavage activity either when present in cis with the ssDNA region or when provided in trans. To test these possibilities, we performed a cleavage assay with two sets of substrates: a 25 bp duplex with one 25-nt 3ʹ overhang or 5ʹ-end-32P-labeled 25-nt ssDNA with an unlabeled blunt-end 25 bp duplex added in trans (Figure 3C). As expected, the duplex substrate was cleaved within the single-stranded overhang region in the presence of Cas4, similar to the duplex substrate tested in Figure 3B (Figure 3D). For the ssDNA substrate, no cleavage was observed in the absence or at low concentrations of dsDNA, while cleavage product accumulated at higher dsDNA concentrations (Figure 3D). A similar amount of cleavage product was observed at dsDNA concentrations ≥ 100 nM, which is higher than the expected concentration of the Cas4-Cas1-Cas2 complex (50 nM). These results are consistent with our model that dsDNA directly stabilizes the complex, and that excess dsDNA should not induce additional activation. Overall, our results show that type I-C Cas4-Cas1-Cas2 adaptation complex can be stabilized by dsDNA and that, within this complex, Cas4 is activated for ssDNA cleavage for substrate provided either in cis or in trans.

Precise PAM-specific DNA processing by Cas4-Cas1-Cas2

We previously showed that Cas4 processes prespacers in a PAM-dependent manner (Lee et al., 2018), but the exact cleavage sites and specificity of Cas4 remain unclear. The observation that Cas4-Cas1-Cas2 can process ssDNA allowed us to more precisely define the cleavage site. By using ssDNA substrates, we could more readily test sequences containing multiple PAM sites or a variety of sequences, and additionally include primer-binding sites for Sanger sequencing reactions. We first conducted prespacer processing assays using ssDNA substrates containing a 5ʹ-GAA-3ʹ PAM between T-rich sequences in the presence of activating dsDNA. Comparison with ddNTP Sanger sequencing reactions revealed that Cas4-Cas1-Cas2 precisely cleaved the ssDNA directly upstream of the PAM, while Cas1-Cas2 or Cas4 alone failed to cleave the substrates (Figure 4A). This cleavage site is consistent with the expected processing site relative to the PAM required to form a functional spacer during spacer acquisition.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig4.jpg
Cas4-Cas1-Cas2 processes directly upstream of PAM sites.

(A) Prespacer processing assay for ssDNA containing one PAM (GAA) site between T-rich sequences. (B) Prespacer processing assay for ssDNA containing three PAM sites with 2-nt intervals. (C) Prespacer processing assay with ssDNA containing three consecutive PAM sites. The first four lanes are Sanger sequencing reactions using the indicated ddNTP. The lane labeled DNA is a negative control reaction in which no proteins were added. Lanes labeled ‘Cas4’, ‘Cas1 + 2’ or ‘Cas4 + 1 + 2’ are reactions performed with the indicated proteins. Arrows indicate the predominant cleavage site.

Figure 4—figure supplement 1.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig4-figsupp1.jpg
Cleavage of ssDNA with three PAMs.

(A) Schematic of ssDNA containing three PAM sites with 10, 8, 6, 4, 2, or 0-nt between the sites. (B) Cleavage assay with ssDNA substrates that have 10, 8, 6 or four nt between PAM sites. Sanger sequencing reaction lanes are labeled with the ddNTP used in the reaction. The lane labeled DNA is a negative control reaction in which no proteins were added. The ‘Cas4 + 1 + 2’ lane is a reaction containing all three proteins.

We next tested whether the Cas4-Cas1-Cas2 could cleave at multiple PAM sites within a single substrate, and whether location of the PAM sites affects the processing activity. We designed ssDNA substrates containing three PAM sites at varying intervals. Substrates with 10, 8, 6, 4 or 2-nt between three PAM sites generated three different sized cleavage products, resulting from cleavage directly upstream of each PAM site (Figure 4B and Figure 4—figure supplement 1). However, when we introduced three PAM sites consecutively on ssDNA substrates, we observed a predominant product at the first PAM position (Figure 4C), indicating that processing was inhibited at the second and third PAM site. Together, these results suggest that the adaptation complex can process multiple PAM sites within a single substrate as long as the PAMs are not consecutive.

To explore whether the PAM-flanking sequences affect cleavage and whether cleavage could be observed at non-PAM sequences, we used PAM-flanking sequences containing either A-T rich or ‘random’ sequences in which all four nucleotides were represented (Figure 5). Although we observed low levels of non-specific degradation in the presence of Cas4-Cas1-Cas2, all substrates displayed a single predominant cleavage product directly upstream of the PAM site (Figure 5A–D). These results indicate that Cas4 is highly PAM specific, as it did not cleave efficiently at other sites in the random sequences.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig5.jpg
Cleavage of ssDNA substrates with different PAM-flanking regions.

(A) Substrate with AT-rich sequences upstream and downstream of the PAM. (B) Substrate with T-rich sequence upstream and random sequence downstream of PAM. (C) Substrate with random sequence upstream and T-rich sequence downstream of PAM. (D) Substrate with random sequence upstream and downstream of PAM. The first four lanes are Sanger sequencing reactions using the indicated ddNTP. The lane labeled DNA is a negative control reaction in which no proteins were added. Lanes labeled ‘Cas4’, ‘Cas1 + 2’ or ‘Cas4 + 1 + 2’ are reactions performed with the indicated proteins. Arrow indicates predominant cleavage site.

Figure 5—figure supplement 1.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig5-figsupp1.jpg
PAM-flanking sequence depletion assay.

(A) Schematic of processing assay. Red arrow indicates a primer used for primer extension assay and the orange arrows contain forward and reverse primers for PCR. (B) Prespacer processing assay using eight substrates containing between 1–4 degenerate nucleotides upstream or downstream of the PAM. Substrates are indicated by the numbers in the legend above the gel. (C) PCR products for DNA only, Cas1-Cas2 and Cas4-Cas1-Cas2. Substrates are indicated as numbers as in (B). (D–E) The fraction of counts for each degenerate sequence is plotted in the absence (x-axis) or presence (y-axis) of Cas4 for substrates with degenerate sequences (D) upstream or (E) downstream of the PAM. No significant differences were observed in the absence or presence of Cas4.

We observed relatively low cleavage for substrates containing random sequences upstream of the PAM, suggesting that the PAM-flanking sequence may have an effect on cleavage efficiency. To test this possibility, we used ssDNA substrates containing degenerate PAM-flanking sequences for Cas4-Cas1-Cas2 cleavage (Figure 5—figure supplement 1A–B). Using a PCR strategy that selectively amplified the uncleaved fraction (Figure 5—figure supplement 1A,C), we analyzed the relative depletion of flanking sequence in the absence or presence of Cas4 by high-throughput sequencing. We detected no significant differences in relative sequence levels for the –Cas4 and +Cas4 samples (Figure 5—figure supplement 1D–E), indicating that all PAM-flanking sequences were cleaved with the same efficiency. Together, our cleavage analyses strongly suggest that Cas4 cleavage specificity is dictated only by the presence of a PAM sequence within a single-stranded region of the substrate.

Cas4 cleavage depends on PAM location within single-stranded overhangs

Our data strongly suggests that Cas4 can cleave PAM sites within single-stranded DNA substrates, and that cleavage occurs at the same site when the ssDNA is provided in cis or in trans with the activating dsDNA (Figure 3B). However, for a duplex substrate containing a ssDNA overhang, it is also possible that Cas1-Cas2-substrate binding positions the single-stranded overhangs into the Cas4 active site. In that case, Cas4 could cleave the DNA based on a ruler mechanism, with the cleavage site defined by the distance between the end of the duplex and the Cas4 active site. To test this possibility, we designed a panel of duplex substrates in which the PAM position was varied within the single-strand overhang (Figure 6A). The four different substrates yielded products of different lengths, indicating that they were cleaved based on the position of the PAM within the single-stranded overhang (Figure 6B). Interestingly, Cas4 processed these substrates to varying degrees (Figure 6B–C). The substrate in which the PAM was located close to the duplex (two nt between duplex and PAM site) was cleaved inefficiently, while the other three substrates were cleaved with similar efficiency (Figure 6C). These data, along with prior results showing that Cas4 cannot cleave a PAM contained within a dsDNA (Lee et al., 2018), suggest that the PAM must be located at a longer distance from the duplex to be accommodated within the Cas4 active site.

An external file that holds a picture, illustration, etc.
Object name is elife-44248-fig6.jpg
Processing of duplex prespacers with varied PAM positions in single-strand overhangs.

(A) Panel of substrates used in processing experiments. The 5ʹ-GAA-3ʹ PAM begins after 2, 4, 6 or eight nt from the end of the duplex. Radiolabel is indicated with an orange star. (B) Polyacrylamide gel image showing cleavage of substrates shown in (A). A second set of +Cas4 reactions were loaded in the last four lanes on the right for ease of comparison of product sizes. (C) Quantitation of percent cleaved for substrates shown in (A). The average of three replicates is shown, with error bars representing standard deviation.

Discussion

Cas4 is a core family of CRISPR adaptation proteins, but its exact mechanism in spacer acquisition is relatively poorly understood. In particular, although there has been some preliminary biochemical evidence that Cas4 directly associates with Cas1-Cas2 to form a higher-order complex, these complexes were either very weak (Lee et al., 2018) or formed only under renaturing conditions (Plagens et al., 2012). Here, we discovered that the presence of dsDNA substrates stabilizes the formation of both Cas1-Cas2 and Cas4-Cas1-Cas2 complexes in the B. halodurans type I-C system. For the first time, we present the architecture of the Cas4-Cas1-Cas2 complex that mediates prespacer selection, processing, and integration during CRISPR adaptation.

Our structural analysis of B. halodurans type I-C adaptation complexes reveals a structure that is mutually exclusive with the previously determined Cas4-Cas1 complex (Lee et al., 2018). In the Cas4-Cas1 complex, the two Cas1 dimers are in close proximity and would exclude the Cas2 dimer. In addition, the interaction surface between Cas1 and Cas4 appears different in the two complexes. In Cas4-Cas1, the two Cas4 molecules each interact with one wing tip of the butterfly-like Cas1 dimers. In the Cas4-Cas1-Cas2 complex, Cas4 appears to interact along the length of one Cas1 wing. These results strongly suggest that Cas4-Cas1 must fully dissociate in order for the Cas1-Cas2 and Cas4-Cas1-Cas2 complex to form. Interestingly, some systems contain Cas4-1 fusion proteins (Hudaiberdiev et al., 2017), and a recent study indicates that the Cas4 domain performs a similar function in prespacer processing within this fusion (Almendros et al., 2019). Complexes formed with Cas4-1 fusions would likely have altered stoichiometry from that observed in our study. The impact of this altered stoichiometry will be an intriguing line of future inquiry.

We previously demonstrated that Cas4 inhibits integration of unprocessed prespacers by Cas1-Cas2 (Lee et al., 2018). These results suggested that Cas4 sequesters 3ʹ-overhangs of the prespacers away from the Cas1 active site prior to processing. Our structural analysis of the Cas4-Cas1-Cas2 complex provides further evidence toward this model. Fitting of structural models into the Cas4-Cas1-Cas2 reconstruction suggests that Cas4 and Cas1 interact extensively and that their active sites may be in close proximity. Thus, it is possible that Cas4 blocks binding of the ssDNA in the Cas1 active site prior to processing. Other RecB-like nucleases bind single-stranded DNA by threading the substrate through a hole formed in the donut-shaped nuclease domain (Zhou et al., 2015). Similar binding by Cas4 may prevent release of the ssDNA until cleavage, at which point the upstream product would be released, allowing handoff to the Cas1 active site and enabling integration.

Previously, we showed that Cas4 processes prespacers with duplexes flanked by 3ʹ overhangs, and that processing activity was independent of the duplex or overhang lengths (Lee et al., 2018). Our current results reveal that the duplex region of these prespacers likely activates Cas4-Cas1-Cas2 for cleavage, and that a similar processing activity can be activated when the duplex and ssDNA are provided in trans. Importantly, single-stranded substrates were processed less efficiently and were not integrated into the CRISPR array when provided in trans with the duplex, while single-strand overhangs of duplex substrates were integrated following processing. These results suggest that interactions of the prespacer duplex along the length of the Cas1-Cas2 core anchors the substrate to the complex, facilitating efficient Cas4 cleavage and direct handoff of the 3ʹ overhangs from Cas4 to Cas1. In the absence of the cis duplex, the ssDNA is likely to be released by the complex upon Cas4 cleavage due to the lack of an anchoring interaction with the complex. Therefore, a duplex DNA containing single-strand overhangs is likely the optimal Cas4-Cas1-Cas2 substrate to enable efficient cleavage and substrate handoff. It remains unclear how these types of prespacers are formed. In other CRISPR-Cas sub-types, Cas4 has been demonstrated to have exonucleolytic activity that can lead to dsDNA unwinding (Lemak et al., 2013; Lemak et al., 2014; Zhang et al., 2012), although we have not observed robust exonuclease or dsDNA cleavage activity for the type I-C BhCas4 (Lee et al., 2018). It is possible that other host factors or conditions are required to unwind ends of dsDNA, or to expose single-stranded overhangs for precise cleavage by Cas4 in the type I-C system.

Surprisingly, Cas4 processing can occur at several locations within both trans and cis ssDNA, as long as enough space is available between cleavage sites and the end of a duplex. Importantly, we do not observe Cas4-dependent PAM processing in the absence of Cas1-Cas2. These observations suggest that the Cas4 active site is activated for cleavage based on interactions with Cas1-Cas2. Once activated, Cas4 can sample any region of a single-stranded DNA that is accessible to the active site. This feature could allow more flexibility in defining prespacer substrates due to the ability of Cas4 to search for PAM sequences within single-stranded overhangs.

Previous in vitro studies have suggested that Cas4 processing is PAM-specific, although the exact position of processing was unclear (Lee et al., 2018; Rollie et al., 2018). We find that processing is highly PAM-specific and occurs precisely upstream of the PAM, consistent with the expected processing position to form a functional prespacer. In these experiments, Cas4 did not appear to have strong cleavage activity at non-PAM sites, suggesting that Cas4-Cas1-Cas2 only processes the PAM-proximal end in type I-C. In type I-A from Pyrococcus furiousus, two distinct Cas4 proteins coordinate the processing of each end of the prespacer (Shiimori et al., 2018). However, most Cas4-containing systems, including type I-C, lack a second cas4 gene. It is possible that in these systems, Cas4 may define the PAM-distal end of the prespacer through an alternative cleavage activity or that another host factor is required for this processing activity.

Formation of functional spacers requires that the PAM end of the prespacer must be integrated at the leader-distal end of the repeat following prespacer processing. The precise details of how spacer orientation is defined during integration remain unknown. In type I-E, one nucleotide of the PAM is retained following prespacer processing, and this nucleotide may help to define the PAM end during integration (Datsenko et al., 2012; Swarts et al., 2012). In the type I-A system, the two Cas4 proteins are required to define orientation (Shiimori et al., 2018), suggesting that their presence in an adaptation complex may define the orientation of the spacer after the prespacer is fully processed. Notably, we observed asymmetrical complexes of Cas4-Cas1-Cas2 containing only one Cas4 subunit. This configuration, along with the hypothesis that Cas4 only processes the PAM end of the prespacer, could suggest that only a single copy of Cas4 is required to form a functional adaptation complex. Indeed, the asymmetrical complex may also define prespacer orientation, based on which end of the prespacer is bound at the Cas4-end of the complex. Our structural model also indicates that Cas4 may be mutually exclusive with binding at the CRISPR array (Figure 2—figure supplement 5), suggesting that the end of the asymmetrical complex lacking Cas4 may preferentially bind to the CRISPR array. We previously showed that integration occurs first at the leader-end of the repeat (Lee et al., 2018), which is also the site of integration for the non-PAM end of the prespacer. Thus, it is possible that an asymmetrical complex may define spacer orientation by ensuring that the non-PAM end is integrated first. Future studies will be required to determine the timing of prespacer processing, CRISPR binding and whether or not Cas4 dissociation is required prior to integration.

Data availability

The negative-stain EM volumes for the Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-target, symmetrical Cas4-Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-prespacer and symmetrical Cas4-Cas1-Cas2-prespacer complexes have been deposited to EMDB under the accession numbers EMDB-20127, EMDB-20128, EMDB-20129, EMDB-20130 and EMDB-20131, respectively.

Contact for reagent and resource sharing

Further information and requests for resources and reagents should be directed to and will be fulfilled by Dipali Sashital (sashital@iastate.edu).

Experimental model and subject details

Escherichia coli BL21 (DE3)

E. coli BL21 (DE3) cells were used for protein production of Cas1 and Cas2. Cells were grown at 16°C in LB medium supplemented with 50 μg/mL kanamycin.

Escherichia coli BL21 Star (DE3)

E. coli BL21 Star (DE3) cells were used for protein production of Cas4 with pRKSUF017 for in vitro experiments. Cells were grown at 18°C in 2xYT medium supplemented with 25 μg/mL carbenicillin and 2.5 μg/mL tetracycline.

Materials and methods

Key resources table

Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (Escherichia coli)BL21 Star (DE3)Thermo Fisher ScientificC6010-03
Strain, strain background (Escherichia coli)BL21 (DE3)New England BiolabsC2527I
Recombinant DNA reagentpET52bEMD Millipore72554
Recombinant DNA reagentpET52b/ His6 Cas4Lee et al., 2018N/A
Recombinant DNA reagentpSV272/ His6-MBP-TEV Cas1Lee et al., 2018N/A
Recombinant DNA reagentpSV272/ His6-MBP-TEV Cas2Lee et al., 2018N/A
Recombinant DNA reagentpRKSUF017Takahashi and Tokumoto, 2002N/A
Commercial assay or kitQIAprep Spin Miniprep KitQiagen#27106
Commercial assay or kitWizard SV Gel and PCR Clean-up systemPromega#A9282
Commercial assay or kitWizard Plus SV minipreps DNA purification systemPromega#A1460
Commercial assay or kitHisPur Ni-NTA Spin columnsThermo Fisher Scientific#88224
Commercial assay or kitHisPur Ni-NTA resinThermo Fisher Scientific#88223
Commercial assay or kitHiTrap SP HPGE Healthcare#7115201
Commercial assay or kitHiTrap Heparin HPGE Healthcare#17-0407-03
Commercial assay or kitHiLoad 16/600 Superdex 200GE Healthcare#28989335
Commercial assay or kitHiLoad 16/600 Superdex 75GE Healthcare#28989333
Commercial assay or kitSequenase Version 2.0 DNA Sequencing KitThermo Fisher Scientific707701KT
Software, algorithmScipionde la Rosa-Trevín et al., 2016scipion.i2pc.es
Software, algorithmXmippAbrishami et al., 2013; Sorzano et al., 2013; Vargas et al., 2013xmipp.i2pc.es
Software, algorithmRELIONScheres, 2012mrc-lmb.cam.ac.uk/reli
Software, algorithmRELIONScheres, 2012on/index.php/Main_Page
Software, algorithmPhyre2Kelley et al., 2015sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id = index
Software, algorithmChimeraPettersen et al., 2004cgl.ucsf.edu/chimera/
Software, algorithmSeggerPintilie et al., 2010cryoem.bcm.edu/cryoem/downloads/segger
OtherFormvar/Carbon 400 mesh, Copper approx. grid hole size: 42 μmTed Pella, Inc.01754 F
OtherPyrobaculum calidifontis Cas4Lemak et al., 2014PDB: 4R5QDeposited data
OtherArchaeoglobus fulgidus Cas1Kim et al., 2013PDB: 4N06Deposited data
OtherBacillus halodurans Cas2Nam et al., 2012PDB: 4ES3Deposited data
OtherEscherichia coli Cas1-Cas2Nuñez et al., 2014PDB: 4P6IDeposited data
OtherEscherichia coli Cas1-Cas2-prespacerNuñez et al., 2015bPDB: 5DS4Deposited data
OtherEnterococcus
faecalis Cas1-Cas2-prespacer
Xiao et al., 2017PDB: 5XVNDeposited data
OtherEnterococcus
faecalis Cas1-Cas2-full site
Xiao et al., 2017PDB: 5XVPDeposited data
OtherBacillus halodurans Cas1-Cas2-targetThis paperEMDB-20127Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-target asymmetricalThis paperEMDB-20128Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-target symmetricalThis paperEMDB-20129Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-prespacer asymmetricalThis paperEMDB-20130Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-prespacer symmetricalThis paperEMDB-20131Deposited data
Chemical compound, drugAgarAMRESCO#J637-1kg
Chemical compound, drugCarbenicillin disodium saltRPI#C46000-25.0
Chemical compound, drugKanamycin monosulfateRPI#K22000-25.0
Chemical compound, drugAmpicillinRPI#A40040-100.0
Chemical compound, drugTetracycline HClRPI#T17000-25.0
Chemical compound, drugLB Broth (Miller)Thermo Fisher Scientific#BP1426-2
Chemical compound, drugIPTGRPI#I56000-100.0
Chemical compound, drugDTTRPI#D11000-100.0
Chemical compound, drugTryptoneRPI#T60060-5000.0
Chemical compound, drugSodium chlorideAMRESCO#7647–14.5
Chemical compound,
drug
Yeast extractThermo Fisher Scientific#BP1422-2
Chemical compound, drugAgaroseThermo Fisher Scientific#BP160-500
Chemical compound, drugHEPESThermo Fisher Scientific#BP310-1
Chemical compound, drugSodium phosphate dibasic heptahydrateThermo Fisher Scientific#S373-3
Chemical compound, drugGlycerolVWR analytical BDH#BDH1172-4LP
Chemical compound, drugImidazoleThermo Fisher Scientific#O31960599
Chemical compound, drugPMSFRPI#P20270-25.0
Chemical compound, drugFerrous sulfateThermo Fisher Scientific#I146-500
Chemical compound, drugFerric sulfateSigma#F3388-250G
Chemical compound, drugL-Cysteine free baseMP Biomedicals#194646
Chemical compound, drugManganese chloride tetrahydrateThermo Fisher Scientific#M87-100
Chemical compound, drugPotassium chlorideRPI#D41000-2500.0
Chemical compound, drugBrilliant blue R-250RPI#B43000-50.0
Chemical compound, drug40% Acrylamide/Bis solution, 19:1Thermo Fisher Scientific#BP1406-1
Chemical compound, drugUreaRPI#U20200-25000.0
Chemical compound, drugBoric acidRPI#B32050-5000.0
Chemical compound, drugTrisRPI#T60040-5000.0
Chemical compound,
drug
EDTAThermo Fisher Scientific#BP120-1
Chemical compound, drug2X RNA loading dyeNew England Biolabs#B0363A
Chemical compound, drugT4 Polynucleotide KinaseNew England Biolabs#M0201L
Chemical compound, drug[γ-32P]-ATPPerkin Elmer#BLU502A250UC
Chemical compound,
drug
Phenol:Chloroform:Isoamyl Alcohol (25:24:1)Thermo Fisher Scientific#15593049

Protein purification

Cas1, Cas2, and Cas4 were purified as previously described (Lee et al., 2018). For complex formation using CRISPR hairpin DNA target, Cas1, Cas2, and hairpin DNA substrates or Cas4, Cas1, Cas2, and hairpin DNA substrates were mixed in equal molar ratios (1:1:1 or 1:1:1:1) and dialyzed against 1 L of buffer A (20 mM HEPES (pH 7.5), 100 mM NaCl, 5% glycerol, 2 mM DTT, and 2 mM MnCl2) overnight at 4°C. The samples were loaded on a 5 mL HiTrap Q column (GE Healthcare) equilibrated with buffer A and the free Cas2 and free DNA were separated from the complex using a gradient of buffer B (20 mM HEPES (pH7.5), 1M NaCl, 5% glycerol, 2 mM DTT, 2 mM MnCl2). Fractions containing all two or three proteins were pooled, concentrated, and further purified using a Superdex 75 10/30 GL column (GE Healthcare) in size exclusion buffer A (20 mM HEPES (pH 7.5), 100 mM KCl, 5% glycerol, 2 mM DTT, and 2 mM MnCl2) for Cas1-Cas2-target complex and size exclusion buffer B (20 mM HEPES (pH 7.5), 250 mM KCl, 5% glycerol, 2 mM DTT, and 2 mM MnCl2) for Cas4-Cas1-Cas2-target complex.

For complex formation using prespacer DNA substrate, 9.8 µM Cas4, 6.5 µM Cas1, 3.3 µM Cas2, and 5 µM prespacer were mixed (final approximate ratio of 3:2:1:1.5) in a final volume of 500 µl in size exclusion buffer B and incubated for 30 min at 4°C. The Cas4-Cas1-Cas2-prespacer complex was purified using a Superdex 75 10/30 GL column (GE Healthcare) in size exclusion buffer B.

DNA substrate preparation

All oligonucleotides were synthesized by Integrated DNA Technologies or Thermo Scientific. Sequences of DNA substrates are shown in Table 1. All DNA substrates were purified on 10% urea-PAGE. Double-stranded DNA was hybridized by heating to 95°C for 5 min followed by slow cooling to room temperature in oligo annealing buffer (20 mM HEPES (pH 7.5), 25 mM KCl, 10 mM MgCl2). Prespacers were labeled with [γ-32P]-ATP (PerkinElmer) and T4 polynucleotide kinase (NEB) for 5′-end labelling. Excess ATP was removed using Illustra Microspin G-25 columns (GE Healthcare).

Table 1.

Oligonucleotides used in this study.
Sequence (5ʹ → 3ʹ)Description
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAAT
ATTGAcgatagTCAATATTTCAATCCACGCACCCATGAAGAGTGC
GACAGCGAAAATC
CRISPR hairpin target*
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAAT
ATTGAGGTAGGTATTG
Mini-CRISPR array
CAATACCTACCTCAATATTTCAATCCACGCACCC
ATGAAGAGTGCGACAGCGAAAATC
RC
CGTAGCTGAGGACCACCAGAACAG TTTTGAATTTTTTTT15-nt 3ʹ overhang prespacer, 4-nt between duplex and PAM††
CGTAGCTGAGGACCACCAGAACAG TTGAATTTTTTTTTT2-nt between duplex and PAM
CGTAGCTGAGGACCACCAGAACAG TTTTTTGAATTTTTT6-nt between duplex and PAM
CGTAGCTGAGGACCACCAGAACAG TTTTTTTTGAATTTT8-nt between duplex and PAM
CTGTTCTGGTGGTCCTCAGCTACG TTTTGAATTTTTTTTRC of previous four oligos
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAATATTGACRISPR DNA substrate
TCAATATTTCAATCCACGCACCCATGAAGAGTGCGACAGCGAAAATCRC
GCGTAGCTGAGGACCACCAGAACAGTTTTGAATTTTTTTTTTTTTTTTTT25-nt 3ʹ overhang prespacer
GCGTAGCTGAGGACCACCAGAACAG25 bp duplex
CTGTTCTGGTGGTCCTCAGCTACGCRC
GCGTAGCTGAGGACCTTTTTTTTTTTTTGAATTTTTTTTTTTTTTCAGGT CGACAAGCTTGT-rich ssDNA prespacer
CAAGCTTGTCGACCTGAAAAAAAAAAAAAATTCAAAAAAAAAAAAA
GGTCCTCAGCTACGC
RC
CTAGTATGATCATGTCCAACGAATCAATACCTACCTCAATGAACGGAT48 bp duplex
ATCCGTTCATTGAGGTAGGTATTGATTCGTTGGACATGATCATACTAGRC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTTTGAATTGAATTGAA
TTTTTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed in 2-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAAAATTCAATTCAATTCA
AAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTTTTTGAAGAAGAATTTTT
TTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites without spacing
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAAAAAATTCTTCTTCAAA
AAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTGAATTTTTTTTTTGAATTTT TTTTTTGAATTTTTTTTTTGACAAGCTTGCGACA3 PAM sites interspersed with 10-nt
TGTCGCAAGCTTGTCAAAAAAAAAATTCAAAAAAAAAATTCAAAAA
AAAAATTCAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTGAATTTTTTTTGAATTTTTTTT
GAATTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 8-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAATTCAAAAAAAATTCAAAAAAAA
TTCAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTGAATTTTTTGAATTTT
TTGAATTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 6-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAATTCAAAAAATTCAAAA
AATTCAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTGAATTTTGAATTTTGAA
TTTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 4-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAATTCAAAATTCAAAA
TTCAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTATATATATATATGAATATATATATATATA CAGGTCGACAAGCTTGAT-rich ssDNA prespacer
CAAGCTTGTCGACCTGTATATATATATATATTCATATATATAT
ATAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTGGTATTCAACAGAATTTTTTTTTTTTTTCA
GGTCGACAAGCTTG
Non-T-rich upstream/T rich downstream ssDNA prespacer
CAAGCTTGTCGACCTGAAAAAAAAAAAAAATTCTGTTGAATACCAAG
GTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTGAACTCGTATTCAACAG CAGGTCGACAAGCTTGT-rich upstream/non T-rich downstream ssDNA prespacer
CAAGCTTGTCGACCTGCTGTTGAATACGAGTTCAAAAAAAAAAAAA
GGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTGGTATTCAACAGAACTCGTATTC AACAGCAGGTCGACAAGCTTGNon-T-rich up- and downstream ssDNA prespacer
CAAGCTTGTCGACCTGCTGTTGAATACGAGTTCTGTTGAATACCAA
GGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCPrimer used for ddNTP Sanger sequencing
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTNNNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGTTTTTNNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGGTTTTTNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGGCTTTTTNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANNNN TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANNNTTTTT CGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANN TTTTTCAGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAAN
TTTTTCATGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTG
N on downstream region
CAAGCTTGTCGACCTGPrimer used for primer extension
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAGCTTGTCGACCTGPrimer used for amplification-Forward
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCGTAGCTGAGGACCPrimer used for amplification-Reverse

*For CRISPR oligonucleotides, leader is in italics, repeat is in bold, and spacer is in plain uppercase font. For hairpin, the loop region is in lowercase.

RC = reverse complement of previous oligonucleotide.

††For cleavage substrates, PAM sequences are underlined.

Negative stain EM sample preparation and data collection

To prepare grids for EM imaging, Cas1-Cas2-target, Cas4-Cas1-Cas2-target or Cas4-Cas1-Cas2-prespacer were diluted to ~100 nM, and 3 µL of sample was applied to a glow-discharged copper 400-mesh continuous carbon grid for one minute at room temperature. The excess sample was blotted with Whatman filter paper, followed by immediate application of 3 µL 2% (w/v) uranyl formate. The excess stain was blotted, followed by immediate application of 3 µL 2% uranyl formate. This step was repeated once more. The grids were allowed to dry for at least 5 min prior to imaging.

Images were collected on a 200 keV JEOL 2100 transmission electron microscope equipped with a Gatan OneView camera at a nominal magnification of 60,000x and pixel size of 1.9 Å. The electron dose was between 30 and 40 electrons/Å2. For each sample, images (200 for Cas1-Cas2-target and Cas4-Cas1-Cas2-target and 93 for Cas4-Cas1-Cas2-prespacer) were collected manually at a defocus range of 1–2.5 µm.

Image processing and single-particle analysis

All image processing and analysis was performed in Scipion v. 1.2 (de la Rosa-Trevín et al., 2016) (RRID:SCR_016738) (available at http://scipion.i2pc.es/). The contrast transfer function (CTF) for each micrograph was estimated using CTFFIND4 (Rohou and Grigorieff, 2015) (RRID:SCR_016732). For each sample,~200 particles were picked using Xmipp manual picking, followed by automated picking using the manually picked particles as a training set (Abrishami et al., 2013; Sorzano et al., 2013; Vargas et al., 2013). In total, 95,669 Cas1-Cas2-target, 115,445 Cas4-Cas1-Cas2-target and 32,494 Cas4-Cas1-Cas2-prespacer particles were present in the initial data set. Particles were extracted using a 160 × 160 pixel box. To reduce computational requirements, the particles were down sampled by a factor of 2 to a final box size of 80 × 80 pixels (~152×152 Å). The particles were normalized and subjected to reference-free 2D classification using RELION 2.1 (Scheres, 2012) (RRID:SCR_016274) (Figure 2—figure supplement 1B). The initial 100 class averages were inspected, and averages with clear structural features, the largest number of particles and size consistent with the molecular weight of the complex were selected for further analysis. These particles were subjected to a second round of 2D classification into 50 classes using RELION to further clean the particles. After selection of the best 2D classes, the Cas1-Cas2-target dataset contained 34,626 particles, the Cas4-Cas1-Cas2-target dataset contained 49,173 particles, and the Cas4-Cas1-Cas2-prespacer dataset contained 19,620 particles.

Particles were next subjected to 3D classification in RELION using the X-ray crystal structure of E. coli Cas1-Cas2 (PDB: 4P6I (Nuñez et al., 2014)) low-pass-filtered to 90 Å as a starting model (Figure 2—figure supplement 2). The target-bound complex datasets were initially classified into six classes, while the prespacer-bound complex was classified into five classes due to the lower number of starting particles. For Cas1-Cas2-target, 11,636 particles from two similar 3D classes with the clearest density were combined (Figure 2—figure supplement 2A). These particles were subjected to 3D refinement using RELION, and the refined volume was used to create a 3D mask. The refined particles were subjected to a second round of classification into three classes using the 3D mask as a reference mask (Figure 2—figure supplement 2A). A class containing 5279 particles with the clearest density was selected. This class contained clear C2 symmetry. These particles were subjected to 3D refinement while enforcing C2 symmetry and using the 3D mask yielding the final reconstruction.

For Cas4-Cas1-Cas2-target, 37,051 particles from four out of six initial 3D classes that appeared to contain Cas1-Cas2 with additional density were selected for further refinement (Figure 2—figure supplement 2B). These particles were subjected to 3D refinement and then further classified into four 3D classes. The resulting classes had clearly defined extra density in comparison to the Cas1-Cas2 3D reconstruction. For two of these classes, the density displayed clear C2 symmetry (Figure 2—figure supplement 2B), with extra density extending from each Cas1 lobe, while for the other two classes, the extra density was only observed extending from one Cas1 lobe. Particles (18,290) from the two symmetrical 3D classes were combined and subjected to 3D refinement while enforcing C2 symmetry. Particles (9,160) from one of the asymmetrical 3D classes were subjected to 3D refinement with C1 symmetry.

For Cas4-Cas1-Cas2-prespacer, 11,001 particles from two out of five initial 3D classes that appeared to contain density in addition to the Cas1-Cas2 core were selected for further refinement (Figure 2—figure supplement 2C). These particles were subjected to 3D refinement and then further classified into three 3D classes. The resulting classes had varying degrees of extra density. Class 1 (3,682 particles) contained no apparent extra density in comparison to Cas1-Cas2-target, while the other two classes resembled the asymmetrical (4668 particles) and symmetrical (2651 particles) Cas4-Cas1-Cas2-target densities. Particles from the symmetrical 3D class were subjected to 3D refinement while enforcing C2 symmetry. Particles from the asymmetrical 3D classes were subjected to 3D refinement with C1 symmetry. For all Cas4-Cas1-Cas2 samples, the refined 3D reconstructions were used to create 3D masks, and each set of particles was subjected to a final round of refinement using the 3D mask as reference mask.

The resolutions of the final 3D reconstruction were 22.1 Å, 19.7 Å, 21.4 Å, 21.6 Å and 24.4 Å for Cas1-Cas2-target, symmetrical Cas4-Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-target, symmetrical Cas4-Cas1-Cas2-prespacer and asymmetrical Cas4-Cas1-Cas2-prespacer, respectively, based on Fourier Shell Correlation (FSC) at a cutoff of 0.5 (Figure 2—figure supplement 1C–D). The 0.5 FSC criterion was used to ensure that resolution was not overestimated. The Euler angle plots for the final 3D reconstructions revealed some preferred orientations but indicated a wide angular distribution in the data (Figure 2—figure supplement 1E).

Structural modelling

Volumes were segmented using Segger (Pintilie et al., 2010) in UCSF Chimera (Pettersen et al., 2004). Structural models for the B. halodurans Cas1 and Cas4 sequences were predicted using the Phyre2 webserver (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) (Kelley et al., 2015). The top results provided structural models based on the closest homologs of BhCas1 and BhCas4 available in the protein databank. For Cas1, the closest homolog is Cas1 from Archaeoglobus fulgidus (PDB 4N06, 28% identical, 65% similar) (Kim et al., 2013). For Cas4, the closest available homolog structure is from Pyrobaculum calidifontis (PDB 4R5Q, 15% identical, 44% similar) (Lemak et al., 2014). The crystal structure of B. halodurans Cas2 (PDB 4ES3) was used for fitting to density assigned to Cas2 (Nam et al., 2012). Fitting of individual copies of Cas1 dimers, Cas2 dimer or Cas4 monomers into assigned densities was performed using the ‘Fit in Segments’ tool in Segger within UCSF Chimera (RRID:SCR_004097) (Pettersen et al., 2004; Pintilie et al., 2010). For Cas4, the top four fits are shown for segmented volumes of the symmetrical and asymmetrical Cas4-Cas1-Cas2-target complexes in Figure 2—figure supplement 4D–E. The cross-correlation score provided by Segger is reported in the figure. The distance between the alpha carbon atom of the Cas1 H234 and Cas4 K110 active site residues was measured using the ‘Distances’ tool in UCSF Chimera. For analyzing fit of Cas1-Cas2 crystal structures in the Cas1-Cas2-target density, the protein subunits of the X-ray crystal structure of E. faecalis Cas1-Cas2 bound to prespacer (PDB: 5XVN [Xiao et al., 2017]) or E. coli Cas1-Cas2 bound to prespacer (PDB 5DS4 [Nuñez et al., 2015b]) were docked into the final 3D reconstruction using the Fit to Segments tool in Segger (Figure 2—figure supplement 3).

Prespacer processing assays

Prespacer processing assays were performed using 25 nM of 5′-radiolabeled substrate with 500 nM Cas4, 200 nM Cas1, 200 nM Cas2 and 1 μM mini-CRISPR DNA (as indicated) or indicated amount of activating dsDNA in integration buffer (20 mM HEPES (pH 7.5), 100 mM KCl, 5% glycerol, 2 mM DTT, and 2 mM MnCl2). The proteins and activating dsDNA were incubated on ice for 10 min prior to addition of the 5ʹ-labeled substrate. All reactions were performed at 65°C for 20 min. Reactions were quenched with 2X RNA loading dye (NEB) and heated at 95°C for 5 min followed by cooling on ice for 3 min. Samples were run on 12% urea-PAGE. The gels were dried and imaged using phosphor screens on a Typhoon imager.

Sequenase Version 2.0 DNA sequencing kit (Applied Biosystems) was used for Sanger sequencing lanes. Samples were prepared by hybridizing template with 5ʹ-radiolabeled primer at 65°C for 2 min and slowly cooling to RT for 30 min. Samples were incubated with the chain terminators (ddGTP, ddCTP, ddATP or ddTTP) at 37°C for 15 min and quenched with 2X RNA dye. The cleaved products were prepared in the presence of 1.2 μM Cas4, 600 nM Cas1, 600 nM Cas2, and 1 μM of activator 48 bp dsDNA and quenched with 2X RNA loading dye. All samples were heated at 95°C for 5 min followed by cooling on ice for 3 min. Samples were run on 0.4 mm 8% urea-PAGE. The gels were dried and imaged using a Typhoon imager.

Cas4 cleavage assays for the panel of duplex substrates in which the PAM position was varied within the single-strand overhang were performed as described above, with the following alterations. For preparing duplex substrates, 25 nM 5ʹ radiolabeled top strand in which the PAM position was varied was annealed to 50 nM unlabeled bottom strand in buffer (20 mM HEPES (pH 7.5), 100 mM KCl, 5% glycerol, 2 mM DTT, 2 mM MnCl2,). The hybridization reactions were incubated at 95°C for 3 min followed by slow cooling to room temperature. A final concentration of 5 nM radiolabeled substrate was used in the reaction. Processing reactions were performed in triplicate, and the intensity of bands was measured by densitometry using ImageJ (Schneider et al., 2012). The fraction cleaved was calculated by dividing the product band by the sum of both bands. The values from three replicates were averaged, and error is reported as standard deviation between the replicates.

Analysis of PAM-flanking sequence depletion

The ssDNA substrates containing between 1–4 degenerate nucleotides upstream or downstream or the PAM were purified with 10% urea-PAGE. For cleavage, 20 nM of each substrate was incubated with 600 nM Cas1, 600 nM Cas2 and 1 μM activator dsDNA in the presence or absence of 1.2 μM Cas4. Samples without Cas4 were used as negative control. Three separate samples were prepared for each condition and treated as separate replicates. After ssDNA cleavage, the uncleaved products were hybridized with a primer that was complementary to the 3ʹ end and extended using Klenow Fragment (NEB).  Samples were extracted with phenol-chloroform-isoamyl alcohol and precipitated with ethanol. The samples were amplified by PCR using Platinum SuperFi DNA polymerase (Thermo) with primers containing Nextera adapters followed by a second round of PCR with primers containing i5 and i7 barcodes. Amplification products were analyzed on 2% SYBR Safe stained agarose gels and quantified using densitometry. Samples were mixed in equal quantities and were run on 2% agarose gel. The band was excised and DNA was purified using QIAquick Gel Extraction kit (Qiagen). Samples were submitted for Illumina MiSeq sequencing to the Iowa State University DNA facility.

The de-multiplexed datasets were analyzed separately to determine the relative read counts for each possible sequence in the degenerate regions. The degenerate regions of the sequences were cut from the reads, and the number of counts for each unique sequence was determined using bash commands. The reads were normalized by dividing the number of reads for each sequence by the total number of reads for the dataset. The normalized reads from three replicates were averaged for each substrate for reactions performed in the absence or presence of Cas4, and error was calculated as standard deviation between the replicates.

Acknowledgements

We thank Sashital lab members for helpful discussions; David Taylor for helpful comments on the manuscript; Levi Baber and members of the ResearchIT group at Iowa State University for computational support; Tracey Stewart and the Roy J Carver High Resolution Microscopy Facility for technical assistance with negative stain EM data collection; and members of the Walter Moss lab at Iowa State University for sharing sequencing gel electrophoresis equipment. This work was supported by an NIH R01 grant (GM115874) to DGS.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Ailong Ke, Cornell University.

Cynthia Wolberger, Johns Hopkins University School of Medicine, United States.

Funding Information

This paper was supported by the following grant:

  • National Institute of General Medical Sciences GM115874 to Dipali G Sashital.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Formal analysis, Investigation, Methodology, Writing—original draft, Writing—review and editing, Performed complex formation of Cas4-Cas1-Cas2-target, prespacer and ssDNA cleavage experiments, and ssDNA specificity assays.

Formal analysis, Investigation, Methodology, Writing—review and editing, Performed Cas4-Cas1-Cas2-prespacer complex formation, negative stain EM data collection, and processing assay for duplex substrates with varied PAM positions.

Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Writing—original draft, Writing—review and editing, Performed negative stain EM data collection and analysis and high-throughput sequencing analysis.

Additional files

Transparent reporting form

Data availability

The negative-stain EM volumes for the Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-target, symmetrical Cas4-Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-prespacer and symmetrical Cas4-Cas1-Cas2-prespacer complexes have been deposited to EMDB under the accession numbers EMDB-20127, EMDB-20128, EMDB-20129, EMDB-20130 and EMDB-20131, respectively.

The following datasets were generated:

Lee H, Dhingra Y, Sashital DG. 2019. Bacillus halodurans Cas1-Cas2-target. Electron Microscopy Data Bank. EMD-20127

Lee H, Dhingra Y, Sashital DG. 2019. Bacillus halodurans Cas4-Cas1-Cas2-target asymmetrical. Electron Microscopy Data Bank. EMD-20128

Lee H, Dhingra Y, Sashital DG. 2019. Bacillus halodurans Cas4-Cas1-Cas2-target symmetrical. Electron Microscopy Data Bank. EMD-20129

Lee H, Dhingra Y, Sashital DG. 2019. Bacillus halodurans Cas4-Cas1-Cas2-prespacer asymmetrical. Electron Microscopy Data Bank. EMD-20130

Lee H, Dhingra Y, Sashital DG. 2019. Bacillus halodurans Cas4-Cas1-Cas2-prespacer symmetrical. Electron Microscopy Data Bank. EMD-20131

The following previously published datasets were used:

Nocek B, Skarina T, Lemak S, Brown G, Savchenko A, Joachimiak A, Yakunin A, Midwest Center for Structural Genomics (MCSG) 2014. Pyrobaculum calidifontis Cas4. Protein Data Bank. 4R5Q

Kim TY, Shin M, Yen LHT, Kim JS. 2013. Crystal structure of Cas1 from Archaeoglobus fulgidus and its nucleolytic activity. Protein Data Bank. 4N06

Ke A, Nam KH. 2012. Double-stranded Endonuclease Activity in B. halodurans Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas2 Protein. Protein Data Bank. 4ES3

Nunez JK, Kranzusch PJ. 2014. Crystal structure of the Cas1-Cas2 complex from Escherichia coli. Protein Data Bank. 4P6I

Nunez JK, Harrington LB, Kranzusch PJ, Engelman AN, Doudna JA. 2015. Crystal structure the Escherichia coli Cas1-Cas2 complex bound to protospacer DNA. Protein Data Bank. 5DS4

Xiao Y, Ng S, Nam KH. 2017. E. far Cas1-Cas2/prespacer binary complex. Protein Data Bank. 5XVN

Xiao Y, Ng S, Nam KH. 2017. E. fae Cas1-Cas2/prespacer/target ternary complex revealing the fully integrated states. Protein Data Bank. 5XVP

References

  • Abrishami V, Zaldívar-Peraza A, de la Rosa-Trevín JM, Vargas J, Otón J, Marabini R, Shkolnisky Y, Carazo JM, Sorzano CO. A pattern matching approach to the automatic selection of particles from low-contrast electron micrographs. Bioinformatics. 2013;29:2460–2468. doi: 10.1093/bioinformatics/btt429. [PubMed] [CrossRef] [Google Scholar]
  • Almendros C, Nobrega FL, McKenzie RE, Brouns SJJ. Cas4-Cas1 fusions drive efficient PAM selection and control CRISPR adaptation. Nucleic Acids Research. 2019:gkz217. doi: 10.1093/nar/gkz217. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Arslan Z, Hermanns V, Wurm R, Wagner R, Pul Ü. Detection and characterization of spacer integration intermediates in type I-E CRISPR-Cas system. Nucleic Acids Research. 2014;42:7884–7893. doi: 10.1093/nar/gku510. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P. CRISPR provides acquired resistance against viruses in prokaryotes. Science. 2007;315:1709–1712. doi: 10.1126/science.1138140. [PubMed] [CrossRef] [Google Scholar]
  • Bolotin A, Quinquis B, Sorokin A, Ehrlich SD. Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology. 2005;151:2551–2561. doi: 10.1099/mic.0.28048-0. [PubMed] [CrossRef] [Google Scholar]
  • Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ, Snijders AP, Dickman MJ, Makarova KS, Koonin EV, van der Oost J. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science. 2008;321:960–964. doi: 10.1126/science.1159689. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Charpentier E, Richter H, van der Oost J, White MF. Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity. FEMS Microbiology Reviews. 2015;39:428–441. doi: 10.1093/femsre/fuv023. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Datsenko KA, Pougach K, Tikhonov A, Wanner BL, Severinov K, Semenova E. Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity system. Nature Communications. 2012;3:945. doi: 10.1038/ncomms1937. [PubMed] [CrossRef] [Google Scholar]
  • de la Rosa-Trevín JM, Quintana A, Del Cano L, Zaldívar A, Foche I, Gutiérrez J, Gómez-Blanco J, Burguet-Castell J, Cuenca-Alba J, Abrishami V, Vargas J, Otón J, Sharov G, Vilas JL, Navas J, Conesa P, Kazemi M, Marabini R, Sorzano CO, Carazo JM. Scipion: a software framework toward integration, reproducibility and validation in 3D electron microscopy. Journal of Structural Biology. 2016;195:93–99. doi: 10.1016/j.jsb.2016.04.010. [PubMed] [CrossRef] [Google Scholar]
  • Deveau H, Barrangou R, Garneau JE, Labonté J, Fremaux C, Boyaval P, Romero DA, Horvath P, Moineau S. Phage response to CRISPR-encoded resistance in streptococcus thermophilus. Journal of Bacteriology. 2008;190:1390–1400. doi: 10.1128/JB.01412-07. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Hochstrasser ML, Taylor DW, Bhat P, Guegler CK, Sternberg SH, Nogales E, Doudna JA. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference. PNAS. 2014;111:6618–6623. doi: 10.1073/pnas.1405079111. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Hochstrasser ML, Doudna JA. Cutting it close: crispr-associated endoribonuclease structure and function. Trends in Biochemical Sciences. 2015;40:58–66. doi: 10.1016/j.tibs.2014.10.007. [PubMed] [CrossRef] [Google Scholar]
  • Hudaiberdiev S, Shmakov S, Wolf YI, Terns MP, Makarova KS, Koonin EV. Phylogenomics of Cas4 family nucleases. BMC Evolutionary Biology. 2017;17:232. doi: 10.1186/s12862-017-1081-1. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Ivančić-Baće I, Cass SD, Wearne SJ, Bolt EL. Different genome stability proteins underpin primed and naïve adaptation in E. coli CRISPR-Cas immunity. Nucleic Acids Research. 2015;43:10821–10830. doi: 10.1093/nar/gkv1213. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Jackson SA, McKenzie RE, Fagerlund RD, Kieper SN, Fineran PC, Brouns SJ. CRISPR-Cas: adapting to change. Science. 2017;356:eaal5056. doi: 10.1126/science.aal5056. [PubMed] [CrossRef] [Google Scholar]
  • Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 2015;10:845–858. doi: 10.1038/nprot.2015.053. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Kieper SN, Almendros C, Behler J, McKenzie RE, Nobrega FL, Haagsma AC, Vink JNA, Hess WR, Brouns SJJ. Cas4 facilitates PAM-Compatible spacer selection during CRISPR adaptation. Cell Reports. 2018;22:3377–3384. doi: 10.1016/j.celrep.2018.02.103. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Kim TY, Shin M, Huynh Thi Yen L, Kim JS. Crystal structure of Cas1 from archaeoglobus fulgidus and characterization of its nucleolytic activity. Biochemical and Biophysical Research Communications. 2013;441:720–725. doi: 10.1016/j.bbrc.2013.10.122. [PubMed] [CrossRef] [Google Scholar]
  • Koonin EV, Makarova KS, Zhang F. Diversity, classification and evolution of CRISPR-Cas systems. Current Opinion in Microbiology. 2017;37:67–78. doi: 10.1016/j.mib.2017.05.008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Lee H, Zhou Y, Taylor DW, Sashital DG. Cas4-Dependent prespacer processing ensures High-Fidelity programming of CRISPR arrays. Molecular Cell. 2018;70:48–59. doi: 10.1016/j.molcel.2018.03.003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Lemak S, Beloglazova N, Nocek B, Skarina T, Flick R, Brown G, Popovic A, Joachimiak A, Savchenko A, Yakunin AF. Toroidal structure and DNA cleavage by the CRISPR-associated [4Fe-4S] cluster containing Cas4 nuclease SSO0001 from sulfolobus solfataricus. Journal of the American Chemical Society. 2013;135:17476–17487. doi: 10.1021/ja408729b. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Lemak S, Nocek B, Beloglazova N, Skarina T, Flick R, Brown G, Joachimiak A, Savchenko A, Yakunin AF. The CRISPR-associated Cas4 protein Pcal_0546 from pyrobaculum calidifontis contains a [2Fe-2S] cluster: crystal structure and nuclease activity. Nucleic Acids Research. 2014;42:11144–11155. doi: 10.1093/nar/gku797. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Li M, Wang R, Zhao D, Xiang H. Adaptation of the haloarcula hispanica CRISPR-Cas system to a purified virus strictly requires a priming process. Nucleic Acids Research. 2014;42:2483–2492. doi: 10.1093/nar/gkt1154. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Liu T, Liu Z, Ye Q, Pan S, Wang X, Li Y, Peng W, Liang Y, She Q, Peng N. Coupling transcriptional activation of CRISPR-Cas system and DNA repair genes by Csa3a in sulfolobus islandicus. Nucleic Acids Research. 2017;45:8978–8992. doi: 10.1093/nar/gkx612. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Marraffini LA. CRISPR-Cas immunity in prokaryotes. Nature. 2015;526:55–61. doi: 10.1038/nature15386. [PubMed] [CrossRef] [Google Scholar]
  • Marraffini LA, Sontheimer EJ. CRISPR interference limits horizontal targeting DNA. Science. 2008;322:1843–1845. doi: 10.1126/science.1165771.. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Mojica FJ, Díez-Villaseñor C, García-Martínez J, Soria E. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. Journal of Molecular Evolution. 2005;60:174–182. doi: 10.1007/s00239-004-0046-3. [PubMed] [CrossRef] [Google Scholar]
  • Nam KH, Ding F, Haitjema C, Huang Q, DeLisa MP, Ke A. Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR)-associated Cas2 protein. Journal of Biological Chemistry. 2012;287:35943–35952. doi: 10.1074/jbc.M112.382598. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Nogales E, Scheres SH. Cryo-EM: a unique tool for the visualization of macromolecular complexity. Molecular Cell. 2015;58:677–689. doi: 10.1016/j.molcel.2015.02.019. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Nuñez JK, Kranzusch PJ, Noeske J, Wright AV, Davies CW, Doudna JA. Cas1-Cas2 complex formation mediates spacer acquisition during CRISPR-Cas adaptive immunity. Nature Structural & Molecular Biology. 2014;21:528–534. doi: 10.1038/nsmb.2820. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Nuñez JK, Lee AS, Engelman A, Doudna JA. Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity. Nature. 2015a;519:193–198. doi: 10.1038/nature14237. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Nuñez JK, Harrington LB, Kranzusch PJ, Engelman AN, Doudna JA. Foreign DNA capture during CRISPR-Cas adaptive immunity. Nature. 2015b;527:535–538. doi: 10.1038/nature15760. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. UCSF chimera--a visualization system for exploratory research and analysis. Journal of Computational Chemistry. 2004;25:1605–1612. doi: 10.1002/jcc.20084. [PubMed] [CrossRef] [Google Scholar]
  • Pintilie GD, Zhang J, Goddard TD, Chiu W, Gossard DC. Quantitative analysis of cryo-EM density map segmentation by watershed and scale-space filtering, and fitting of structures by alignment to regions. Journal of Structural Biology. 2010;170:427–438. doi: 10.1016/j.jsb.2010.03.007. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Plagens A, Tjaden B, Hagemann A, Randau L, Hensel R. Characterization of the CRISPR/Cas subtype I-A system of the hyperthermophilic crenarchaeon thermoproteus tenax. Journal of Bacteriology. 2012;194:2491–2500. doi: 10.1128/JB.00206-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. 2005;151:653–663. doi: 10.1099/mic.0.27437-0. [PubMed] [CrossRef] [Google Scholar]
  • Redding S, Sternberg SH, Marshall M, Gibb B, Bhat P, Guegler CK, Wiedenheft B, Doudna JA, Greene EC. Surveillance and processing of foreign DNA by the Escherichia coli CRISPR-Cas System. Cell. 2015;163:854–865. doi: 10.1016/j.cell.2015.10.003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Rohou A, Grigorieff N. CTFFIND4: fast and accurate defocus estimation from electron micrographs. Journal of Structural Biology. 2015;192:216–221. doi: 10.1016/j.jsb.2015.08.008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Rollie C, Schneider S, Brinkmann AS, Bolt EL, White MF. Intrinsic sequence specificity of the Cas1 integrase directs new spacer acquisition. eLife. 2015;4:e08716. doi: 10.7554/eLife.08716. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Rollie C, Graham S, Rouillon C, White MF. Prespacer processing and specific integration in a type I-A CRISPR system. Nucleic Acids Research. 2018;46:1007–1020. doi: 10.1093/nar/gkx1232. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Sashital DG, Wiedenheft B, Doudna JA. Mechanism of foreign DNA selection in a bacterial adaptive immune system. Molecular Cell. 2012;46:606–615. doi: 10.1016/j.molcel.2012.03.020. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Scheres SH. RELION: implementation of a bayesian approach to cryo-EM structure determination. Journal of Structural Biology. 2012;180:519–530. doi: 10.1016/j.jsb.2012.09.006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Schneider CA, Rasband WS, Eliceiri KW. NIH image to ImageJ: 25 years of image analysis. Nature Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Semenova E, Jore MM, Datsenko KA, Semenova A, Westra ER, Wanner B, van der Oost J, Brouns SJ, Severinov K. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. PNAS. 2011;108:10098–10103. doi: 10.1073/pnas.1104144108. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Shiimori M, Garrett SC, Graveley BR, Terns MP. Cas4 Nucleases Define the PAM, Length, and Orientation of DNA Fragments Integrated at CRISPR Loci. Molecular Cell. 2018;70:814–824. doi: 10.1016/j.molcel.2018.05.002. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Sorzano CO, de la Rosa Trevín JM, Otón J, Vega JJ, Cuenca J, Zaldívar-Peraza A, Gómez-Blanco J, Vargas J, Quintana A, Marabini R, Carazo JM. Semiautomatic, high-throughput, high-resolution protocol for three-dimensional reconstruction of single particles in electron microscopy. Methods in Molecular Biology. 2013;950:171–193. doi: 10.1007/978-1-62703-137-0_11. [PubMed] [CrossRef] [Google Scholar]
  • Sternberg SH, Redding S, Jinek M, Greene EC, Doudna JA. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature. 2014;507:62–67. doi: 10.1038/nature13011. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Swarts DC, Mosterd C, van Passel MW, Brouns SJ. CRISPR interference directs strand specific spacer acquisition. PLOS ONE. 2012;7:e35888. doi: 10.1371/journal.pone.0035888. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Takahashi Y, Tokumoto U. A third bacterial system for the assembly of iron-sulfur clusters with homologs in archaea and plastids. Journal of Biological Chemistry. 2002;277:28380–28383. doi: 10.1074/jbc.C200365200. [PubMed] [CrossRef] [Google Scholar]
  • Vargas J, Abrishami V, Marabini R, de la Rosa-Trevín JM, Zaldivar A, Carazo JM, Sorzano COS. Particle quality assessment and sorting for automatic and semiautomatic particle-picking techniques. Journal of Structural Biology. 2013;183:342–353. doi: 10.1016/j.jsb.2013.07.015. [PubMed] [CrossRef] [Google Scholar]
  • Wang J, Li J, Zhao H, Sheng G, Wang M, Yin M, Wang Y, Wang J, Li J, Zhao H. Structural and Mechanistic Basis of PAM-Dependent Spacer Acquisition in CRISPR-Cas Systems. Cell. 2015;163:840–853. doi: 10.1016/j.cell.2015.10.008. [PubMed] [CrossRef] [Google Scholar]
  • Xiao Y, Ng S, Nam KH, Ke A. How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Nature. 2017;550:137–141. doi: 10.1038/nature24020. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhang J, Kasciukovic T, White MF. The CRISPR associated protein Cas4 is a 5' to 3' DNA exonuclease with an iron-sulfur cluster. PLOS ONE. 2012;7:e47232. doi: 10.1371/journal.pone.0047232. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhang Z, Pan S, Liu T, Li Y, Peng N. Cas4 nucleases can effect specific integration of CRISPR spacers. Journal of Bacteriology. 2019 doi: 10.1128/JB.00747-18. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
  • Zhou C, Pourmal S, Pavletich NP. Dna2 nuclease-helicase structure, mechanism and regulation by rpa. eLife. 2015;4:e09832. doi: 10.7554/eLife.09832. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
2019; 8: e44248.
Published online 2019 Apr 30. doi: 10.7554/eLife.44248.047

Decision letter

Ailong Ke, Reviewing Editor and Malcolm F White, Reviewer
Ailong Ke, Cornell University;

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "The Cas4-Cas1-Cas2 complex mediates precise prespacer processing during CRISPR adaptation" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editor, and the evaluation has been overseen by Cynthia Wolberger as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Malcolm F White (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. While all reviewers recognize that the significance of the biochemical work, the consensus is that the conclusions from the EM work need to be strengthened, either by improving the structure resolution, or through extensive mutagenesis validation. A summary of their review comments can be found below.

Summary:

Cas4 is prevalent in many CRISPR systems. The Sashital group and several other labs defined its important function in processing the 3ʹ-end of prespacer in a PAM-dependent and Cas1-Cas2-dependent fashion. The authors previously reported the low-resolution EM structure of the Cas4-Cas1 complex. Important questions remain to be answered. Does PAM-dependent prespacer processing take place in this complex? How does the processing lead to directional spacer integration into the CRISPR array? In this manuscript, Lee et al. reconstituted the Cas4-Cas1-Cas2 complex by including a dsDNA substrate, and presented a 22 Å negative-staining EM structure of the Bacillus halodurans Cas4-Cas1-Cas2 structure. Cas4 was found to bind Cas1 in either symmetrical or asymmetrical fashion, suggesting that its interaction with Cas1 is dynamic and could be influenced by the presence of a PAM sequence in the ssDNA overhang. The proximity of the nuclease center in Cas4 to the integration active site of Cas1 suggests a mechanism for substrate handoff following PAM-dependent processing. The PAM-dependent prespacer processing more active and precise in the context of this complex,. The authors further propose a mechanism explaining how Cas4-mediated PAM-end processing may lead to directional integration of the mature prespacer into the CRISPR locus.

Essential revisions:

Major points on the negative staining EM work:

1) The current resolution of the EM structure leaves room for ambiguous interpretations. Reviewers feel that conclusions of this work would be significantly strengthened by improving the resolution to a range (i.e. 6-10 Å) that allows unambiguous docking of high-resolution structures. If it turns out improving the structure resolution is not practical at this point, the authors are strongly encouraged to carry out a set of mutagenesis experiments to support their docking model. Given that two different sets of Cas4-Cas1 contacts were observed in the Cas4-Cas1 and Cas4-Cas1-Cas2 structures, the authors may want to mutagenize the interface residues in each of the structure, and evaluate the functional consequences.

2) The Figures 2 and Figure 2—figure supplement 4 were not clear and the reviewers could not get a good handle on the orientation of the Cas4 proteins relative to the DNA. Figure 2 shows 20 Å EM reconstruction of the Cas1-2 and Cas1-2-4 complexes. At this resolution, the Cas1-2 complex model is probably OK and matches known structures. The extra "blob" in the Cas1-2-4 complexes is assigned to Cas4, however it is smaller than the smallest known Cas4, the monomeric protein from P. calidifontis. It also does not fit with the EM structure of the Cas1-4 complex previously reported by the same authors (Lee, 2018). Although the FeS cluster appeared to help, this assignment should be treated with caution. In particular, the orientation chosen for the modelled Cas4 looks close to arbitrary and should not be used as a basis for further interpretation about active site positioning.

3) The absence of density corresponding to the CRISPR DNA is troublesome and needs to be discussed by the authors. What is the rationale of using the CRISPR leader-repeat-spacer instead of the prespacer duplex to promote the formation of the Cas4-Cas1-Cas2 complex? It appears that initially the authors reasoned that target-binding may promote complex formation, but their later data seems to argue that the Cas4-Cas1-Cas2 complex contacted the DNA rather nonspecifically, and through the prespacer-binding interface. If this is the case, to avoid possible misconceptions, the authors should make it clear that the contact does not reflect how Cas1-Cas2 recognizes the target sequence.

Major points on the biochemistry work:

1) The biochemistry experiments in this manuscript were done using prespacer substrates containing a 'perfect' duplex with ss-overhangs provided either in cis or in trans. Such substrates are rarely found in vivo. In cases when the PAM is buried in the dsDNA region, can Cas4 process the dsDNA and correctly cleave after the 3'-PAM? Can the product be integrated into the CRISPR substrate?

2) What would happen when a ss-PAM is 1-2 nucleotide away (too far or too close) from the 5-nt spacing? Does the Cas4 cleavage dictate where the integration happens?

3) Figure 3 presents some nice data showing that prespacers are cleaved by Cas4 and that this is stimulated by the presence of ds CRISPR DNA. The data on ssDNA substrates, which is discussed in depth, is likely not that relevant to the adaptation process and activity is much weaker for these substrates. In the figure legend, part C is not described. This figure does lack an important control – use of a duplex substrate with ss overhangs that lacks a PAM sequence to discriminate between a ruler mechanism and a sequence specific mechanism for cleavage by Cas4 of the relevant prespacer structures.

4) Figure 4 and 5 show convincing data supporting PAM-dependent cleavage activity by Cas1-2-4 on ssDNA substrates. This provides important new information on PAM removal by Cas4 during the capture process. It is unclear why this work has not been done with the relevant substrate, the gapped duplex shown in Figure 3B, which is cleaved more efficiently that non-relevant ssDNA. It would considerably strengthen the paper if the authors could provide some evidence that the same PAM-specific cleavage is observed with relevant duplex substrates, and this should not be hard to do.

Contributor Information

Ailong Ke, Cornell University.

Malcolm F White, University of St Andrews, United Kingdom.

2019; 8: e44248.
Published online 2019 Apr 30. doi: 10.7554/eLife.44248.048

Author response

Essential revisions:

Major points on the negative staining EM work:

1) The current resolution of the EM structure leaves room for ambiguous interpretations. Reviewers feel that conclusions of this work would be significantly strengthened by improving the resolution to a range (i.e. 6-10 Å) that allows unambiguous docking of high-resolution structures. If it turns out improving the structure resolution is not practical at this point, the authors are strongly encouraged to carry out a set of mutagenesis experiments to support their docking model. Given that two different sets of Cas4-Cas1 contacts were observed in the Cas4-Cas1 and Cas4-Cas1-Cas2 structures, the authors may want to mutagenize the interface residues in each of the structure, and evaluate the functional consequences.

The reviewers’ concern that the structural model is ambiguous is valid; however, the suggested improvement to resolution could not be completed in the timescale of revisions (see comment 1 below) and the mutagenesis experiments are extremely challenging due to lack of high-resolution structures for B. halodurans Cas1 and Cas4 (see comment 2 below). Because we were unable to complete these experiments requested by the reviewers, we have made extensive changes to our structural modelling experiments, which are outlined in our response to concern #2.

1) An improvement in resolution would certainly be beneficial but will require considerable investment of time, as well as resources that are not readily available to us. The resolution range suggested by the reviewers is outside the theoretical limits of negative stain EM and would therefore require cryo-EM. This instrumentation is not currently available to our lab, which is why we pursued negative stain EM. We have also initiated an off-site collaboration in the hopes of obtaining a higher-resolution structure by cryo-EM. Unfortunately, as is often the case when moving from negative stain to cryo, it seems that cryo-EM structure determination from these samples will require considerable sample optimization. Because we are pursuing this work through collaboration, it is not possible to complete this optimization in the timeframe allowed for manuscript revisions. We also want to note that a high-resolution structure of BhCas4 is not available (see next comment) and Cas4 is a compact protein with few distinctive structural features. So, it is unclear whether the resolution range suggested by the reviewers would enable unambiguous docking of the Pcal Cas4 structure in the BhCas4 density. Generally, < 6 Å resolution is required to clearly define all secondary-structural features, especially beta-strands, in a protein. We believe that this goal will have to remain the subject of future studies.

2) We appreciate the reviewers’ suggestion of testing mutations in the predicted Cas4-Cas1 interface. Indeed, prior to our initial submission of this manuscript, we had attempted to predict Cas4 and Cas1 residues that could disrupt interactions upon mutation based on our structural models. However, it is important to note that high-resolution structures are not available for the B. halodurans Cas1 and Cas4 sequences. While a structure of a relatively close Cas1 homolog (Archaeoglobus fulgidus, PDB 4N06, 28% identical, 65% similar) is available, the closest available Cas4 homolog structure (Pyrobaculum calidifontis, PDB 4R5Q, 15% identical, 44% similar) has several predicted structural divergences (Figure 2 —figure supplement 4A and B).

Most importantly, the entire N-terminal helix of PcCas4 is likely not present in BhCas4, while a ~20 amino acid C-terminal domain in BhCas4 is not present in the PcCas4 structure (Figure 2—figure supplement 4A). In an attempt to resolve these structural differences, we used the Phyre2 server to predict structural models of BhCas1 and BhCas4 (Figure 2—figure supplement 4B). However, we are not confident in the exact placement of amino acid sidechains within these models, especially given the lack of a potential BhCas4 C-terminal domain in the structural model. Cas4-Cas1 disruption experiments would test for negative results (i.e. loss of complex formation or Cas4 processing) and the lack of a high-resolution BhCas4 structure to guide putatively disruptive mutations could lead to false-positive loss of function (e.g. due to protein misfolding) or false negatives (e.g. due to compensatory structural rearrangements). Thus, mutagenesis experiments are premature at this point and could exacerbate the risk of overinterpreting the structural model. We have instead provided more information on potential fits of the BhCas4 structural model in the assigned Cas4 density, as outlined in the response below.

2) The Figures 2 and Figure 2—figure supplement 4 were not clear and the reviewers could not get a good handle on the orientation of the Cas4 proteins relative to the DNA. Figure 2 shows 20 Å EM reconstruction of the Cas1-2 and Cas1-2-4 complexes. At this resolution, the Cas1-2 complex model is probably OK and matches known structures. The extra "blob" in the Cas1-2-4 complexes is assigned to Cas4, however it is smaller than the smallest known Cas4, the monomeric protein from P. calidifontis. It also does not fit with the EM structure of the Cas1-4 complex previously reported by the same authors (Lee, 2018). Although the FeS cluster appeared to help, this assignment should be treated with caution. In particular, the orientation chosen for the modelled Cas4 looks close to arbitrary and should not be used as a basis for further interpretation about active site positioning.

As mentioned above, we agree with the reviewers that it is important to ensure the reader understands the ambiguity of our structural model. We had attempted to emphasize this ambiguity in the previous version of the manuscript, but the reviewers’ comments indicate that this could be improved further. We have now performed new structural modelling experiments that better emphasize this ambiguity. We have made several changes to Figure 2 and the figure supplements in an attempt to make the structural model clearer.

First, we would like to note that our data very strongly suggests that the extra density observed in the Cas4-Cas1-Cas2 complex is due to the presence of Cas4. For example, in Figure 1B-D, we show that Cas4 co-elutes with Cas1, Cas2 and DNA, while in Figure 1E-F, we demonstrate clearly visible extra density in 2D class averages that is only present when Cas4 is present in the sample. We therefore feel confident in our conclusion that this density can be assigned to Cas4.

The reviewers are correct that some of the PcCas4 structure lay outside the density in our previous version of Figure 2. There are multiple possible reasons for why the assigned Cas4 density is smaller than the PcCas4 structure. As noted above, the two structures are likely different as BhCas4 lacks the long N-terminal domain (~50 amino acids) and instead contains a short C-terminal domain (~20 amino acids). Although BhCas4 is overall longer, many of the insertion sequences are predicted to be in loop regions that are likely flexible and not resolved in the EM map (Figure 2 —figure supplement 4). Overall, these differences may result in a more compact BhCas4 structure in comparison to the PcCas4 we used in our previous modeling experiments. In addition, as we previously noted in the text, the Cas4 density segmentation may be incomplete due to low resolution, resulting in the apparently smaller Cas4 density. This effect of low resolution is reported in the publication describing the Segger tool used for our segmentation (Pintilie et al., 2010). It is therefore possible that Cas4 lies at least partially in the “Cas1” density.

This is now stated more explicitly in the text:

“The segmented density for Cas4 is smaller than the structure and parts of the structure fit into the Cas1 density, suggesting that the segmentation between Cas1 and Cas4 densities was incomplete due to low resolution as has been observed previously (Pintilie et al., 2010).”

We agree with the reviewers that the previous model based on the Fe2S2 cluster should be treated with caution. To ensure that this model did not lead to overinterpretation, we have removed it from the revised manuscript. We have instead included a new set of modelling experiments that better reflect the possible orientations Cas4 may adopt within the assigned density. We made two changes to our prior modeling experiments. First, we now use crystal structures (BhCas2 PDB 4ES3) or structural models (BhCas1 and BhCas4 predicted by Phyre2 server) of the actual B. halodurans sequences. As noted above, these predicted structural models may better reflect the size and shape of the actual sequences present in the complex. Second, we now use the “Fit to Segments” tool within the Segger package in UCSF Chimera to perform structural fitting (rather than the “Fit in Map” tool). This tool enables output of multiple possible top fits, allowing us to show several possible orientations for Cas4 to be docked into the assigned density. With our new modeling experiments, much of the BhCas4 structural model fits within the Cas4 density with reasonable cross-correlation scores (Figure 2—figure supplement 4). In all orientations, Cas4 is located in close proximity to the Cas1 active site, although the distance between the active sites varies. The new modeling and figures will provide a more comprehensive view of how Cas4 may interact with Cas1, and we hope this will address the reviewers’ concerns about overinterpretation of our structural data. The new modeling is shown in Figure 2 and Figure 2—figure supplement 4 and described in the Results section and Materials and methods section. Descriptions of how Cas1-Cas2 crystal structures fit into the Cas1-Cas2 density are now shown in Figure 2—figure supplement 3.

3) The absence of density corresponding to the CRISPR DNA is troublesome and needs to be discussed by the authors. What is the rationale of using the CRISPR leader-repeat-spacer instead of the prespacer duplex to promote the formation of the Cas4-Cas1-Cas2 complex? It appears that initially the authors reasoned that target-binding may promote complex formation, but their later data seems to argue that the Cas4-Cas1-Cas2 complex contacted the DNA rather nonspecifically, and through the prespacer-binding interface. If this is the case, to avoid possible misconceptions, the authors should make it clear that the contact does not reflect how Cas1-Cas2 recognizes the target sequence.

We agree that more discussion on the absence of DNA density is important and have added additional information on this in the text in paragraph six of subsection “Architecture of the Cas4-Cas1-Cas2 complex”. First, we note that it is well established that it is difficult to visualize nucleic acids by negative stain (e.g. Nogales et al., 2015 and Hochstrasser et al., 2014), so it is not unexpected that DNA is not visible in most of our EM densities. Our biochemical results show that the DNA co-elutes with the protein components of the complex (Figures 1C-D), which strongly suggests that the DNA is part of the complex, even though the density is not visible. The highest resolution Cas4-Cas1-Cas2 EM density (symmetrical complex with CRISPR hairpin target bound) does appear to have additional density along the prespacer binding surface, although we cannot unambiguously assign this density to the target DNA. Although we were not expecting the target DNA to bind along this surface, in hindsight, it seems likely that this is the preferred DNA-binding site for Cas1-Cas2. Interactions with the DNA backbone are non-specific along this surface in all known Cas1-Cas2-prespacer structures (Wang et al., 2015, Nuñez et al., 2015b, Xiao et al., 2017). In contrast, specific interactions with CRISPR DNA may be transient, and only stabilized upon formation of the half-site integration intermediate with the prespacer substrate. Consistently, there are no known structures of Cas1-Cas2 bound to only a CRISPR DNA, while structures of half-site and full-site intermediate-bound Cas1-Cas2 are available (Xiao et al., 2017, and PMID 28729350).

We have included discussion of this possibility in the Results section:

“Although we hypothesized that the CRISPR hairpin target would stabilize the Cas1-Cas2 complex by binding along the repeat-binding surface, our structural studies of complexes formed in the presence of the hairpin target suggest this is not the case. Notably, the prespacer-binding surface of Cas2 interacts with DNA through non-specific backbone contacts (Nuñez et al., 2015b; Wang et al., 2015; Xiao et al., 2017), and no structure of Cas1-Cas2 bound to CRISPR DNA alone has been previously reported. This could suggest that any dsDNA, including the CRISPR target, may preferentially bind along the prespacer-binding surface and that other DNA substrates binding in that location could promote stable complex formation.”

The reviewers are correct in interpreting our reasoning for using the hairpin target DNA. It has been challenging to isolate a Cas4-Cas1-Cas2 complex, due to the difficulty of working with Cas4, which is prone to aggregation and precipitation. We previously made extensive attempts to form the complex in the presence of prespacer and other types of dsDNA, and our attempts to do so with the CRISPR hairpin target proved the most successful. However, with recent improvements in our Cas4 purification and complex formation protocol, we have now been able to form the Cas4-Cas1-Cas2 complex in the presence of prespacer, rather than target DNA. These new experiments, including structures of symmetrical and asymmetrical Cas4-Cas1-Cas2prespacer are added to the manuscript in a new section titled “Formation of the Cas4-Cas1Cas2 complex with prespacer substrate” (subsection “Formation of the Cas4-Cas1-Cas2 complex with prespacer substrate”, Figure 1—figure supplement 2 and Figure 2—figure supplements 1, 2 and 6).

Major points on the biochemistry work:

1) The biochemistry experiments in this manuscript were done using prespacer substrates containing a 'perfect' duplex with ss-overhangs provided either in cis or in trans. Such substrates are rarely found in vivo. In cases when the PAM is buried in the dsDNA region, can Cas4 process the dsDNA and correctly cleave after the 3'-PAM? Can the product be integrated into the CRISPR substrate?

In our previous publication, we tested Cas4 cleavage of several types of substrates, including dsDNA containing a PAM (Figure S2 in Lee et al. Mol Cell, 2018). We do not observe cleavage activity with any substrates except duplexes with 3ʹ overhangs. The new activity described in the current manuscript reinforces the idea that Cas4 only cleaves ssDNA, and indeed this is expected given the nature of the RecB nuclease domain. Thus, in order to cleave a PAM within a dsDNA, Cas4 would require a DNA unwinding activity that we have been unable to detect. These data indicate that additional factors or alternative conditions may be necessary to expose single-stranded DNA for Cas4 cleavage.

We have added the following sentences to the Discussion section to discuss this idea:

“Therefore, a duplex DNA containing single-strand overhangs is likely the optimal Cas4-Cas1-Cas2 substrate to enable efficient cleavage and substrate handoff. It remains unclear how these types of prespacers are formed. In other CRISPR-Cas sub-types, Cas4 has been demonstrated to have exonucleolytic activity that can lead to dsDNA unwinding (Lemak et al., 2013, 2014a; Zhang et al., 2012), although we have not observed robust exonuclease or dsDNA cleavage activity for the type I-C BhCas4 (Lee et al., 2018). It is possible that other host factors or conditions are required to unwind ends of dsDNA, or to expose single-stranded overhangs for precise cleavage by Cas4 in the type I-C system.”

2) What would happen when a ss-PAM is 1-2 nucleotide away (too far or too close) from the 5-nt spacing? Does the Cas4 cleavage dictate where the integration happens?

The question of PAM location within single-stranded overhang is interesting, and one we had not previously explored. We addressed the question of the effect of PAM location on single-strand overhang processing with a new set of experiments, described in our response to the next concern. For the second question, we addressed where integration happens in our previous publication (Figure 5 in Lee et al. Mol Cell, 2018). In that publication, we performed highthroughput sequencing experiments of half-site intermediate products to show that integration at the leader-repeat junction is highly precise. That experiment showed that the processing position did not affect the location of integration. However, integration at the repeat-spacer junction is much less specific. It may be interesting to determine whether the PAM position in the overhang affects the location of integration at the repeat-spacer junction. However, due to the relative rarity of integration at the repeat-spacer junction, this experiment requires high-throughput sequencing experiments. These experiments are costly and time consuming and we believe they will have to remain the subject of future experiments.

3) Figure 3 presents some nice data showing that prespacers are cleaved by Cas4 and that this is stimulated by the presence of ds CRISPR DNA. The data on ssDNA substrates, which is discussed in depth, is likely not that relevant to the adaptation process and activity is much weaker for these substrates. In the figure legend, part C is not described. This figure does lack an important control – use of a duplex substrate with ss overhangs that lacks a PAM sequence to discriminate between a ruler mechanism and a sequence specific mechanism for cleavage by Cas4 of the relevant prespacer structures.

There are several points in this concern that we will address individually:

“In the figure legend, part C is not described.”

We thank the reviewers for pointing out a typo in the figure legend for Figure 3 (panels C and D were described as panels D and E in the previous version of the manuscript). This is now corrected.

“Figure 3 presents some nice data showing that prespacers are cleaved by Cas4 and that this is stimulated by the presence of ds CRISPR DNA. The data on ssDNA substrates, which is discussed in depth, is likely not that relevant to the adaptation process and activity is much weaker for these substrates.”

To clarify, we do not observe stimulation of duplex prespacer cleavage in the presence of CRISPR DNA, although this was what we intended to test with this experiment. As observed in Figure 3B, the amount of product is similar in the 9th and 11th lane of the gel, indicating that CRISPR DNA does not enhance duplex prespacer cleavage. We were instead surprised to find that a dsDNA induces cleavage of a trans ssDNA. Although it is unclear whether this activity is relevant to the adaptation process, we believe that it informs on the mechanism of Cas4-Cas1Cas2, which is why it is emphasized in this figure and throughout the text. The experiments in Figure 3 establish that once the Cas1-Cas2 complex is stabilized by binding to a dsDNA, it can activate Cas4 for cleavage of ssDNA. This cleavage is indeed more efficient when the ssDNA is covalently attached to the Cas1-Cas2-bound duplex, which likely localizes the ssDNA in close proximity to the Cas4 active site. However, the fact that Cas4 can cleave a trans ssDNA demonstrates that the single-stranded substrate is not positioned in the Cas4 active site solely based on the interaction with Cas1-Cas2. Instead, Cas4 can bind and cleave any ssDNA once activated by Cas1-Cas2. We have added more clarification on this point throughout the text.

We also added the following to the Discussion to emphasize the implications of the ssDNA cleavage:

“Surprisingly, Cas4 processing can occur at several locations within both trans and cis ssDNA, as long as enough space is available between cleavage sites and the end of a duplex. Importantly, we do not observe Cas4-dependent PAM processing in the absence of Cas1Cas2. These observations suggest that the Cas4 active site is activated for cleavage based on interactions with Cas1-Cas2. Once activated, Cas4 can sample any region of a single-stranded DNA that is accessible to the active site. This feature could allow more flexibility in defining prespacer substrates due to the ability of Cas4 to search for PAM sequences within single-stranded overhangs.”

“This figure does lack an important control – use of a duplex substrate with ss overhangs that lacks a PAM sequence to discriminate between a ruler mechanism and a sequence specific mechanism for cleavage by Cas4 of the relevant prespacer structures.”

We performed the control experiment suggested by the reviewers in a previous publication (Figure 3 in Lee et al. Mol Cell, 2018,) and did not observe cleavage when no PAM is present in the single-stranded overhang. We now explicitly mention this in the Results section:

“Importantly, we previously showed that cleavage of the duplex prespacer is dependent on having a PAM present in the single-stranded overhang, indicating that cleavage occurs in a PAM-dependent manner (Lee et al., 2018).”

However, the question of a potential ruler mechanism is important and one we had not entirely ruled out in our previous experiments. To address this question, as well as the first question proposed in concern #2, we have performed additional processing experiments using a panel of duplex substrates in which the PAM position is varied within the single-stranded overhang. Consistent with our other data, we observe that the PAM position does determine where processing occurs, indicating a PAM-dependent cleavage mechanism rather than a ruler mechanism. However, the position of the PAM is important for cleavage, as a PAM sequence that is too close to the duplex was not processed efficiently. This suggests that the single-stranded overhang must be long enough to stretch from the end of the duplex-binding region of Cas1-Cas2 to the active site of Cas4, but longer single-stranded regions can be cleaved at any PAM-containing region. This is reminiscent of the trans-ssDNA cleavage observed in our other experiments, and suggests that the Cas1-Cas2 complex does not position the ssDNA in the Cas4 overhang as long as the PAM is far enough away from the duplex. These experiments are described in a new Results section “Cas4 cleavage depends on PAM location within single-stranded overhangs” (Figure 6).

4) Figure 4 and 5 show convincing data supporting PAM-dependent cleavage activity by Cas1-2-4 on ssDNA substrates. This provides important new information on PAM removal by Cas4 during the capture process. It is unclear why this work has not been done with the relevant substrate, the gapped duplex shown in Figure 3B, which is cleaved more efficiently that non-relevant ssDNA. It would considerably strengthen the paper if the authors could provide some evidence that the same PAM-specific cleavage is observed with relevant duplex substrates, and this should not be hard to do.

We had multiple reasons for using the ssDNA in our sequencing gel experiments. First, using long single-stranded substrates enabled the introduction of primer-binding sites for Sanger sequencing, allowing us to run the sequencing lanes alongside processing reactions for unambiguous detection of the cleavage site. Second, we wanted to demonstrate that the only sites cleaved by Cas4 are PAM sites by using a panel of different sequences. Finally, we wanted to test whether multiple PAM sites could be cleaved within a single substrate. These latter two experiments were more easily done with the ssDNA, where the whole DNA would be subject to potential cleavage by Cas4. In contrast, only the single-strand overhang is subject to cleavage by Cas4 in the duplex substrate, limiting the amount of sequence we could interrogate for cleavage. Therefore, by using this experimental system, we were able to observe Cas4 specificity more effectively. We added the following sentence to better explain our reasoning for this line of experimentation:

“By using ssDNA substrates, we could more readily test sequences containing multiple PAM sites or a variety of sequences, and additionally include primer-binding sites for Sanger sequencing reactions.”

Unfortunately, the experiment suggested by the reviewers is not as straightforward as they propose given our recent personnel changes, and we believe we have already demonstrated that the single-strand overhangs are cleaved at the same position as the ssDNA. In Figure 3B, we show that the single-stranded and duplex substrates are cleaved at identical positions, indicating that the duplex is also cleaved in a PAM-specific manner. In addition, we have now performed the experiments described above in which cleavage site within single-strand overhang varies based on the location of the PAM. Overall, these experiments show that Cas4 only cleaves single-stranded sequences in a PAM-dependent manner, and that these substrates are cleaved in the same position regardless of whether they are fully single-stranded or partially duplexed.


Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

Feedback