GEO Profiles Links for Nucleotide (Select 26092533) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 20

Select item 441805771.

Mapk8 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS2924, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44180577

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249602772.

Mapk8 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS2078, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24960277

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44542853.

Mapk8 - Preimplantation development

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8485 (ID_REF), GDS578, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3066H10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4454285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 279692774.

Mapk8 - Estradiol effect on the uterus: time course

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS2208, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27969277

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553905775.

Mapk8 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS3386, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55390577

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 46452316.

Mapk8 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m20967_a_at (ID_REF), GDS592, C130022H23 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4645231

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249369777.

Mapk8 - Estren effect on the uterus: time course

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS2077, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24936977

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44546698.

Mapk8 - Preimplantation development

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8869 (ID_REF), GDS578, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3073D04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4454669

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 130220779.

Mapk8 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS1360, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13022077

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614478510.

Mapk8 - Blastocyst dormancy and activation comparison

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8485 (ID_REF), GDS752, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3066H10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6144785

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1770027711.

Mapk8 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS1675, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17700277

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3031173112.

Mapk8 - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m20967_a_at (ID_REF), GDS2327, C130022H23 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30311731

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748885213.

Mapk8 - MPSS transcriptome analysis project

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTTGGGTGTTTCCTG (ID_REF), GDS868, AK047936

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7488852

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 447758514.

Mapk8 - Zygotic gene activation

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8485 (ID_REF), GDS579, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3066H10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4477585

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299877715.

Mapk8 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS1359, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12998777

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614516916.

Mapk8 - Blastocyst dormancy and activation comparison

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8869 (ID_REF), GDS752, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3073D04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6145169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447796917.

Mapk8 - Zygotic gene activation

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL870, 8869 (ID_REF), GDS579, AB005663, AK030767, AK032486, AK039129, AK039254, AK043102, AK044768, AK047936, AK053062, BC053027, H3073D04-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4477969

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 633747718.

Mapk8 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS775, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6337477

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762655219.

Mapk8 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTTGGGTGTTTCCTG (ID_REF), GDS878, AK047936

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7626552

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 596417720.

Mapk8 - High fat diet effect on aorta: time course

Annotation:: Mapk8, mitogen-activated protein kinase 8

Organism:: Mus musculus

Reporter:: GPL891, 14877 (ID_REF), GDS735, AK047936, A_51_P422342 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5964177

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26092533) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 20

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity