Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Sepp1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Sepp1, selenoprotein P, plasma, 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCGCTTACTGTGAGGAGA (ID_REF), GDS878, BC001991
DataSet type:
Expression profiling by MPSS, count, 6 samples
2.
Value/Rank Plot

Rgs7 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Rgs7, regulator of G protein signaling 7
Organism:
Mus musculus
Reporter:
GPL1010, GATCCGTGTCCTTTTCTTTT (ID_REF), GDS878, BC051133
DataSet type:
Expression profiling by MPSS, count, 6 samples
3.
Value/Rank Plot

Cgn - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Cgn, cingulin
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTTGCTTTTCTCAAGA (ID_REF), GDS878, BC042459
DataSet type:
Expression profiling by MPSS, count, 6 samples
4.
Value/Rank Plot

Map4k3 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Map4k3, Mitogen-activated protein kinase kinase kinase kinase 3
Organism:
Mus musculus
Reporter:
GPL1010, GATCCAGCGCATCGGCAGCG (ID_REF), GDS878, CR514878
DataSet type:
Expression profiling by MPSS, count, 6 samples
5.
Value/Rank Plot

Gfm1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Gfm1, G elongation factor, mitochondrial 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGGAGAAATTTTCCAA (ID_REF), GDS878, NM_138591
DataSet type:
Expression profiling by MPSS, count, 6 samples
6.
Value/Rank Plot

Ftsj3 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Ftsj3, FtsJ homolog 3 (E. coli)
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGAAGGAGCAGAAGTA (ID_REF), GDS878, AW209806
DataSet type:
Expression profiling by MPSS, count, 6 samples
7.
Value/Rank Plot

Dctn4 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Dctn4, Dynactin 4
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCTGGGGGTGGGGAGG (ID_REF), GDS878, AW491336
DataSet type:
Expression profiling by MPSS, count, 6 samples
8.
Value/Rank Plot

Mterf1a - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Mterf1a, mitochondrial transcription termination factor 1a
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCAGAGATTTTGTCAG (ID_REF), GDS878, NM_001013023
DataSet type:
Expression profiling by MPSS, count, 6 samples
9.
Value/Rank Plot

MPSS analysis of BLK CL.4 and liver cells

Annotation:
CDNA clone IMAGE:3825518
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTCCGTTCTTCTTCCA (ID_REF), GDS878, BY709547
DataSet type:
Expression profiling by MPSS, count, 6 samples
10.
Value/Rank Plot

Diaph1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Diaph1, diaphanous related formin 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCATTCCTCAAGACTA (ID_REF), GDS878, BC012974
DataSet type:
Expression profiling by MPSS, count, 6 samples
11.
Value/Rank Plot

Chst12 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Chst12, carbohydrate sulfotransferase 12
Organism:
Mus musculus
Reporter:
GPL1010, GATCGTGCTGAGCGAGAGCC (ID_REF), GDS878, NM_021528
DataSet type:
Expression profiling by MPSS, count, 6 samples
12.
Value/Rank Plot

Zfp553 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Zfp553, zinc finger protein 553
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTTTCAGCCTTAGTCT (ID_REF), GDS878, NM_146201
DataSet type:
Expression profiling by MPSS, count, 6 samples
13.
Value/Rank Plot

Dimt1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Dimt1, DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
Organism:
Mus musculus
Reporter:
GPL1010, GATCACTTTTGTTCGGAAAA (ID_REF), GDS878, BC019799
DataSet type:
Expression profiling by MPSS, count, 6 samples
14.
Value/Rank Plot

Adgra2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Adgra2, adhesion G protein-coupled receptor A2
Organism:
Mus musculus
Reporter:
GPL1010, GATCAAGTGAGAGGACAGAG (ID_REF), GDS878, NM_054044
DataSet type:
Expression profiling by MPSS, count, 6 samples
15.
Value/Rank Plot

Eda2r - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Eda2r, ectodysplasin A2 receptor
Organism:
Mus musculus
Reporter:
GPL1010, GATCAACTTTCTTCCCTAAG (ID_REF), GDS878, AK029268
DataSet type:
Expression profiling by MPSS, count, 6 samples
16.
Value/Rank Plot

Acaa1a - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Acaa1a, Acetyl-Coenzyme A acyltransferase 1A
Organism:
Mus musculus
Reporter:
GPL1010, GATCAATGAGGCCTTTGCAA (ID_REF), GDS878, BQ946447
DataSet type:
Expression profiling by MPSS, count, 6 samples
17.
Value/Rank Plot

Fscn1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Fscn1, fascin actin-bundling protein 1
Organism:
Mus musculus
Reporter:
GPL1010, GATCACTCTGAGAGCCTCCA (ID_REF), GDS878, BC010338
DataSet type:
Expression profiling by MPSS, count, 6 samples
18.
Value/Rank Plot

MPSS analysis of BLK CL.4 and liver cells

Annotation:
No annotation available
Organism:
Mus musculus
Reporter:
GPL1010, GATCATCCTGCCGGAGATGG (ID_REF), GDS878
DataSet type:
Expression profiling by MPSS, count, 6 samples
19.
Value/Rank Plot

Tor1b - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Tor1b, torsin family 1, member B
Organism:
Mus musculus
Reporter:
GPL1010, GATCTACTCAGACAAGGGCT (ID_REF), GDS878, AK035602
DataSet type:
Expression profiling by MPSS, count, 6 samples
20.
Value/Rank Plot

Tubb5 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Tubb5, tubulin, beta 5 class I
Organism:
Mus musculus
Reporter:
GPL1010, GATCCCCAACAATGTCAAGA (ID_REF), GDS878, M28732
DataSet type:
Expression profiling by MPSS, count, 6 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center