Format
Items per page
Sort by

Send to:

Choose Destination

Links from GEO Profiles

Items: 1 to 20 of 200

1.
Value/Rank Plot

Cd4 - Salt sensitive hypertension: kidney (RG-U34A)

Annotation:
Cd4, Cd4 molecule
Organism:
Rattus norvegicus
Reporter:
GPL85, M15768_at (ID_REF), GDS1545, 24932 (Gene ID), M15768
DataSet type:
Expression profiling by array, count, 6 samples
2.
Value/Rank Plot

Cd4 - SIRT1 deficiency effect on the brain

Annotation:
Cd4, CD4 antigen
Organism:
Mus musculus
Reporter:
GPL8321, 1419696_at (ID_REF), GDS4895, 12504 (Gene ID), NM_013488
DataSet type:
Expression profiling by array, transformed count, 8 samples
3.
Value/Rank Plot

CD4 - Far-upstream element binding protein inactivation

Annotation:
CD4, CD4 molecule
Organism:
Homo sapiens
Reporter:
GPL3779, 1727690_1 (ID_REF), GDS2573, NM_000616
DataSet type:
Expression profiling by array, log2 ratio, 6 samples
4.
Value/Rank Plot

LOC100510175 - Metastatic prostate cancer (HG-U95C)

Annotation:
LOC100510175, hypothetical LOC100510175 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63906_f_at (ID_REF), GDS2547, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 100510175 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 116933 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2140 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 2494 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 2673 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 2786 (Gene ID), 283507 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285521 (Gene ID), 28985 (Gene ID), 29063 (Gene ID), 3070 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 342132 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 3594 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 4123 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51380 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 57116 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84105 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84376 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85373 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 8634 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 164 samples
5.
Value/Rank Plot

LOC100506114 - Metastatic prostate cancer (HG-U95C)

Annotation:
LOC100506114, uncharacterized LOC100506114 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63705_f_at (ID_REF), GDS2547, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285498 (Gene ID), 285521 (Gene ID), 2898 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51230 (Gene ID), 51380 (Gene ID), 51520 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 5300 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54456 (Gene ID), 54811 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 5589 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 64581 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 79830 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 85476 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 164 samples
6.
Value/Rank Plot

TRAF3IP2-AS1 - Metastatic prostate cancer (HG-U95C)

Annotation:
TRAF3IP2-AS1, TRAF3IP2 antisense RNA 1 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 56963_f_at (ID_REF), GDS2547, 126298 (Gene ID), 162514 (Gene ID), 25923 (Gene ID), 283335 (Gene ID), 29934 (Gene ID), 340277 (Gene ID), 51306 (Gene ID), 55211 (Gene ID), 57474 (Gene ID), 643749 (Gene ID), 6564 (Gene ID), 80228 (Gene ID), 920 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9866 (Gene ID)
DataSet type:
Expression profiling by array, count, 164 samples
7.
Value/Rank Plot

CD4 - Rheumatoid arthritis: synovial tissues

Annotation:
CD4, CD4 molecule
Organism:
Homo sapiens
Reporter:
GPL1740, 11164 (ID_REF), GDS1857, AA025939
DataSet type:
Expression profiling by array, count, 8 samples
8.
Value/Rank Plot

LOC100510175 - Obesity: adipocyte expression profile (HG-U95C)

Annotation:
LOC100510175, hypothetical LOC100510175 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63906_f_at (ID_REF), GDS1496, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 100510175 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 116933 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2140 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 2494 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 2673 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 2786 (Gene ID), 283507 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285521 (Gene ID), 28985 (Gene ID), 29063 (Gene ID), 3070 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 342132 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 3594 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 4123 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51380 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 57116 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84105 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84376 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85373 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 8634 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 39 samples
9.
Value/Rank Plot

LOC100506114 - Obesity: adipocyte expression profile (HG-U95C)

Annotation:
LOC100506114, uncharacterized LOC100506114 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63705_f_at (ID_REF), GDS1496, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285498 (Gene ID), 285521 (Gene ID), 2898 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51230 (Gene ID), 51380 (Gene ID), 51520 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 5300 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54456 (Gene ID), 54811 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 5589 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 64581 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 79830 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 85476 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 39 samples
10.
Value/Rank Plot

TRAF3IP2-AS1 - Obesity: adipocyte expression profile (HG-U95C)

Annotation:
TRAF3IP2-AS1, TRAF3IP2 antisense RNA 1 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 56963_f_at (ID_REF), GDS1496, 126298 (Gene ID), 162514 (Gene ID), 25923 (Gene ID), 283335 (Gene ID), 29934 (Gene ID), 340277 (Gene ID), 51306 (Gene ID), 55211 (Gene ID), 57474 (Gene ID), 643749 (Gene ID), 6564 (Gene ID), 80228 (Gene ID), 920 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9866 (Gene ID)
DataSet type:
Expression profiling by array, count, 39 samples
11.
Value/Rank Plot

CD4 - Crohn disease and ulcerative colitis comparison

Annotation:
CD4, CD4 molecule
Organism:
Homo sapiens
Reporter:
GPL284, 62B12 (ID_REF), GDS1330, AA025939, IMAGE:365647 (CLONE ID)
DataSet type:
Expression profiling by array, transformed count, 31 samples
12.
Value/Rank Plot

Cd4 - MPSS transcriptome analysis project

Annotation:
Cd4, CD4 antigen
Organism:
Mus musculus
Reporter:
GPL1010, GATCCACAGCCTCCTCTGCC (ID_REF), GDS868, BC039137
DataSet type:
Expression profiling by MPSS, count, 87 samples
13.
Value/Rank Plot

LOC100506114 - Prostate adenocarcinoma response to radiation (HG-U95C)

Annotation:
LOC100506114, uncharacterized LOC100506114 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63705_f_at (ID_REF), GDS721, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285498 (Gene ID), 285521 (Gene ID), 2898 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51230 (Gene ID), 51380 (Gene ID), 51520 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 5300 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54456 (Gene ID), 54811 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 5589 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 64581 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 79830 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 85476 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 5 samples
14.
Value/Rank Plot

LOC100510175 - Normal human tissue expression profiling (HG-U95C)

Annotation:
LOC100510175, hypothetical LOC100510175 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63906_f_at (ID_REF), GDS424, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 100510175 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 116933 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2140 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 2494 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 2673 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 2786 (Gene ID), 283507 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285521 (Gene ID), 28985 (Gene ID), 29063 (Gene ID), 3070 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 342132 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 3594 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 4123 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51380 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 57116 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84105 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84376 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85373 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 8634 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 24 samples
15.
Value/Rank Plot

LOC100506114 - Normal human tissue expression profiling (HG-U95C)

Annotation:
LOC100506114, uncharacterized LOC100506114 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63705_f_at (ID_REF), GDS424, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285498 (Gene ID), 285521 (Gene ID), 2898 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51230 (Gene ID), 51380 (Gene ID), 51520 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 5300 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54456 (Gene ID), 54811 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 5589 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 64581 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 79830 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 85476 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 24 samples
16.
Value/Rank Plot

TRAF3IP2-AS1 - Normal human tissue expression profiling (HG-U95C)

Annotation:
TRAF3IP2-AS1, TRAF3IP2 antisense RNA 1 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 56963_f_at (ID_REF), GDS424, 126298 (Gene ID), 162514 (Gene ID), 25923 (Gene ID), 283335 (Gene ID), 29934 (Gene ID), 340277 (Gene ID), 51306 (Gene ID), 55211 (Gene ID), 57474 (Gene ID), 643749 (Gene ID), 6564 (Gene ID), 80228 (Gene ID), 920 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9866 (Gene ID)
DataSet type:
Expression profiling by array, count, 24 samples
17.
Value/Rank Plot

LOC100510175 - Skeletal repair in non-union fractures (HG-U95C)

Annotation:
LOC100510175, hypothetical LOC100510175 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63906_f_at (ID_REF), GDS369, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 100510175 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 116933 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2140 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 2494 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 2673 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 2786 (Gene ID), 283507 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285521 (Gene ID), 28985 (Gene ID), 29063 (Gene ID), 3070 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 342132 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 3594 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 4123 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51380 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 57116 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84105 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84376 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85373 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 8634 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 4 samples
18.
Value/Rank Plot

LOC100506114 - Skeletal repair in non-union fractures (HG-U95C)

Annotation:
LOC100506114, uncharacterized LOC100506114 (multiple annotations exist)
Organism:
Homo sapiens
Reporter:
GPL93, 63705_f_at (ID_REF), GDS369, 100128477 (Gene ID), 100130872 (Gene ID), 100302692 (Gene ID), 100505876 (Gene ID), 100506019 (Gene ID), 100506114 (Gene ID), 10160 (Gene ID), 10491 (Gene ID), 10585 (Gene ID), 10944 (Gene ID), 1106 (Gene ID), 11185 (Gene ID), 11238 (Gene ID), 11261 (Gene ID), 112770 (Gene ID), 1238 (Gene ID), 126298 (Gene ID), 147172 (Gene ID), 147841 (Gene ID), 148362 (Gene ID), 162514 (Gene ID), 168451 (Gene ID), 171220 (Gene ID), 196 (Gene ID), 202374 (Gene ID), 2188 (Gene ID), 22884 (Gene ID), 22982 (Gene ID), 23259 (Gene ID), 23345 (Gene ID), 23461 (Gene ID), 23515 (Gene ID), 23545 (Gene ID), 253512 (Gene ID), 256369 (Gene ID), 25923 (Gene ID), 26036 (Gene ID), 26190 (Gene ID), 26238 (Gene ID), 26268 (Gene ID), 26272 (Gene ID), 27067 (Gene ID), 27351 (Gene ID), 284 (Gene ID), 284996 (Gene ID), 285498 (Gene ID), 285521 (Gene ID), 2898 (Gene ID), 333 (Gene ID), 340277 (Gene ID), 3426 (Gene ID), 342909 (Gene ID), 374354 (Gene ID), 388387 (Gene ID), 3925 (Gene ID), 440026 (Gene ID), 440603 (Gene ID), 4719 (Gene ID), 472 (Gene ID), 50809 (Gene ID), 51004 (Gene ID), 51008 (Gene ID), 51073 (Gene ID), 51149 (Gene ID), 51230 (Gene ID), 51380 (Gene ID), 51520 (Gene ID), 51631 (Gene ID), 5287 (Gene ID), 5300 (Gene ID), 53820 (Gene ID), 54097 (Gene ID), 54456 (Gene ID), 54811 (Gene ID), 54822 (Gene ID), 55211 (Gene ID), 5524 (Gene ID), 5589 (Gene ID), 57146 (Gene ID), 57474 (Gene ID), 57551 (Gene ID), 57563 (Gene ID), 58538 (Gene ID), 5872 (Gene ID), 5939 (Gene ID), 6138 (Gene ID), 6295 (Gene ID), 6300 (Gene ID), 6302 (Gene ID), 64581 (Gene ID), 65988 (Gene ID), 682 (Gene ID), 692205 (Gene ID), 6938 (Gene ID), 7165 (Gene ID), 7203 (Gene ID), 7903 (Gene ID), 79158 (Gene ID), 79400 (Gene ID), 79591 (Gene ID), 79707 (Gene ID), 79830 (Gene ID), 80228 (Gene ID), 80741 (Gene ID), 81034 (Gene ID), 8341 (Gene ID), 84108 (Gene ID), 84144 (Gene ID), 84240 (Gene ID), 84572 (Gene ID), 84961 (Gene ID), 85028 (Gene ID), 85377 (Gene ID), 8542 (Gene ID), 85476 (Gene ID), 8888 (Gene ID), 89801 (Gene ID), 9114 (Gene ID), 9180 (Gene ID), 920 (Gene ID), 9473 (Gene ID), 9563 (Gene ID), 9578 (Gene ID), 9638 (Gene ID), 9731 (Gene ID), 9866 (Gene ID), 9929 (Gene ID), 9990 (Gene ID)
DataSet type:
Expression profiling by array, count, 4 samples
19.
Value/Rank Plot

Cd4 - Androgen deprivation effect on CD4 T-cells

Annotation:
Cd4, CD4 antigen
Organism:
Mus musculus
Reporter:
GPL11180, 1419696_PM_at (ID_REF), GDS5301, NM_013488
DataSet type:
Expression profiling by array, count, 4 samples
20.
Value/Rank Plot

CD4 - Recurrent squamous cell carcinoma of the lung: primary tumor

Annotation:
CD4, CD4 molecule
Organism:
Homo sapiens
Reporter:
GPL3877, 6.1.4.4 (ID_REF), GDS2506, S79267
DataSet type:
Expression profiling by array, log2 ratio, 51 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center