GEO Profile Links for Gene (Select 71791) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1025

<< First< Prev

Page of 52

Next >Last >>

Select item 39279751.

Cpa4 - Intestinal tract gene expression (MG-U74C)

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL83, 167133_r_at (ID_REF), GDS524, 71791 (Gene ID), AV009555

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3927975

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1108595872.

Cpa4 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS5052, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110859587

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1070976653.

Cpa4 - Stearoyl-CoA desaturase-1 deficiency effect on the skin

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS4910, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 107097665

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 429036654.

Cpa4 - Folate deficiency and arsenic effect on the skin

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS2872, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 42903665

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1182950875.

Cpa4 - Adam10 deficiency effect on the epidermis

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS5229, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118295087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1107861876.

Cpa4 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS5050, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110786187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1223986657.

Cpa4 - p38-alpha deficient keratinocyte response to ultraviolet-B in vitro

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS5335, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 122398665

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1201574658.

Cpa4 - Topical protein tyrosine kinase inhibitor effect on graft model of alopecia areata: time course

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS5273, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 31 samples

ID:: 120157465

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546297789.

Cpa4 - Skin carcinogenesis model

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL4234, 3610100 (ID_REF), GDS3334, NM_027926

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54629778

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12783534110.

Cpa4 - Rhabdomyosarcoma model

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6481, 3610100 (ID_REF), GDS5527, NM_027926, Cpa4 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127835341

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8903896511.

Cpa4 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS4408, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89038965

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747115512.

Cpa4 - MPSS transcriptome analysis project

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCCTGGCTCTGCCTT (ID_REF), GDS868, BC061206

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7471155

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11082288713.

Cpa4 - Pristane-induced arthritis effect on AIRmin low acute inflammation model: footpad

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS5051, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110822887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12975138714.

Cpa4 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS5645, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129751387

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11233046515.

Cpa4 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS5091, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112330465

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10905308716.

Cpa4 - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL6246, 10537026 (ID_REF), GDS4985, NM_027926, BC061206, chr6:30568369-30591747 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109053087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3079766517.

Cpa4 - Interferon regulatory factor 6 null mutation effect on the skin

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS2359, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30797665

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11875616518.

Cpa4 - Skin response to injury: time course

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS5239, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 118756165

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12020396519.

Cpa4 - Alopecia areata model: skin

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS5274, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 120203965

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7225026520.

Cpa4 - Psoriasis mouse models

Annotation:: Cpa4, carboxypeptidase A4

Organism:: Mus musculus

Reporter:: GPL1261, 1453770_at (ID_REF), GDS3907, 71791 (Gene ID), AV294399

DataSet type:: Expression profiling by array, transformed count, 34 samples

ID:: 72250265

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 52

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 71791) (1025)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1025

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity