GEO Profile Links for Gene (Select 243862) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 346

<< First< Prev

Page of 18

Next >Last >>

Select item 74729611.

Psg22 - MPSS transcriptome analysis project

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGAACCCCTCCATTT (ID_REF), GDS868, NM_001004152

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7472961

GEO DataSets Gene Chromosome neighbors

Select item 83721412.

Psg22 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Psg22, Pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL1230, 41 (ID_REF), GDS947, BG076719

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8372141

GEO DataSets Gene Chromosome neighbors

Select item 517954933.

Psg22 - Interleukin-22 effect on colon cultures

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL2872, 7393 (ID_REF), GDS3226, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51795493

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 529537934.

Psg22 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL2872, 7393 (ID_REF), GDS3259, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52953793

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 285174395.

Psg22 - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL2987, 4739 (ID_REF), GDS2227, Y13557

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28517439

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 296723906.

Psg22 - Atherogenic diet effect on the liver: time course

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL1292, AGmmB231118 (ID_REF), GDS2292, Y13557

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 29672390

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1316551887.

Psg22 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P533653 (ID_REF), GDS5818, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131655188

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 83806058.

Psg22 - Lacrimal gland and cornea burn: time course (SMCmou8400A)

Annotation:: Psg22, Pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL1230, 8505 (ID_REF), GDS947, BG076719

DataSet type:: Expression profiling by array, log ratio, 46 samples

ID:: 8380605

GEO DataSets Gene Chromosome neighbors

Select item 1182657889.

Psg22 - Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P533653 (ID_REF), GDS5228, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118265788

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7571438410.

Psg22 - Cyclophosphamide effect on peripheral blood leukocytes: time course

Annotation:: Psg22, pregnancy-specific glycoprotein 22 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL13209, 014D20 (ID_REF), GDS4004, NM_054063, NM_027403, NM_001004152

DataSet type:: Expression profiling by array, log2 ratio, 30 samples

ID:: 75714384

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11674545111.

Psg22 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3078396 (ID_REF), GDS5185, NM_001004152, PSG22 (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116745451

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12100445212.

Psg22 - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3157677 (ID_REF), GDS5293, NM_001004152, PSG22 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 121004452

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 13046198813.

Psg22 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P533653 (ID_REF), GDS5666, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130461988

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10922077614.

Psg22 - Diabetic db/db heart response to rosiglitazone

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL4134, 10876 (ID_REF), GDS4990, NM_001004152, A_52_P533653 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109220776

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7572828415.

Psg22 - Cyclophosphamide effect on splenocytes: time course

Annotation:: Psg22, pregnancy-specific glycoprotein 22 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL13209, 014D20 (ID_REF), GDS4005, NM_054063, NM_027403, NM_001004152

DataSet type:: Expression profiling by array, log2 ratio, 38 samples

ID:: 75728284

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12333475116.

Psg22 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3078396 (ID_REF), GDS5360, NM_001004152, PSG22 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123334751

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 5026165517.

Psg22 - Reversine effect on myoblast cell line

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL2995, 471274 (ID_REF), GDS3159, NM_001004152

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 50261655

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9234506118.

Psg22 - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6246, 10550496 (ID_REF), GDS4433, NM_001004152, BC050099, BC080694, chr7:18718082-18727248 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92345061

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11813464219.

Psg22 - Spleen response to infection by Plasmodium yoelii strains N67 and N67C

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3157677 (ID_REF), GDS5225, NM_001004152

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118134642

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10830734120.

Psg22 - Claudin 18 deficiency effect on the lung

Annotation:: Psg22, pregnancy-specific glycoprotein 22

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3078396 (ID_REF), GDS4961, NM_001004152

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 108307341

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 18

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 243862) (346)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 346

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity