Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1537

1.
Value/Rank Plot

Ybx2 - Small-molecule inhibition of BRDT effect on testis

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_3086192 (ID_REF), GDS5172, NM_016875, YBX2 (ORF)
DataSet type:
Expression profiling by array, count, 6 samples
2.
Value/Rank Plot

Ybx2 - Gonadal development: ovaries and testes

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS4503, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 6 samples
3.
Value/Rank Plot

Ybx2 - Polyubiquitin knockout effect on testis: time course

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS3906, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 16 samples
4.
Value/Rank Plot

Ybx2 - Taf7l deficiency effect on the testis

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS2857, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 4 samples
5.
Value/Rank Plot

Ybx2 - Male germ cells

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS2390, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 8 samples
6.
Value/Rank Plot

Ybx2 - Ribonucleoprotein- and polysome-associated mRNAs of the testis: time-course

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL339, 1420762_a_at (ID_REF), GDS2277, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 18 samples
7.
Value/Rank Plot

Ybx2 - TSLC1/IGSF4 deficiency effect on testis

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL81, 104440_at (ID_REF), GDS2026, 53422 (Gene ID), AF073954
DataSet type:
Expression profiling by array, count, 4 samples
8.
Value/Rank Plot

Ybx2 - Age effect on hematopoietic stem cells

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS1803, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 8 samples
9.
Value/Rank Plot

Ybx2 - Telomere dysfunction effect on male germ cells

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL81, 104440_at (ID_REF), GDS1248, 53422 (Gene ID), AF073954
DataSet type:
Expression profiling by array, count, 8 samples
10.
Value/Rank Plot

Ybx2 - Spermatogenesis and testis development time course (MG-U74A)

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL81, 104440_at (ID_REF), GDS605, 53422 (Gene ID), AF073954
DataSet type:
Expression profiling by array, count, 22 samples
11.
Value/Rank Plot

Ybx2 - Small-molecule inhibition of BRDT effect on testis

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1241788 (ID_REF), GDS5172, NM_016875, YBX2 (ORF)
DataSet type:
Expression profiling by array, count, 6 samples
12.
Value/Rank Plot

Ybx2 - Testes of various subspecies

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL81, 104440_at (ID_REF), GDS1884, 53422 (Gene ID), AF073954
DataSet type:
Expression profiling by array, count, 8 samples
13.
Value/Rank Plot

Ybx2 - Androgen effect on spermatogenesis: time course

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL8321, 1420762_a_at (ID_REF), GDS1367, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 10 samples
14.
Value/Rank Plot

Ybx2 - MPSS transcriptome analysis project

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1010, GATCCATCCTTATTGTTCCG (ID_REF), GDS868, NM_016875
DataSet type:
Expression profiling by MPSS, count, 87 samples
15.
Value/Rank Plot

Ybx2 - Sex specific transcription in somatic and reproductive tissues

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL339, 1420762_a_at (ID_REF), GDS565, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 48 samples
16.
Value/Rank Plot

Ybx2 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL11180, 1420762_PM_a_at (ID_REF), GDS4791, NM_016875
DataSet type:
Expression profiling by array, transformed count, 24 samples
17.
Value/Rank Plot

Ybx2 - Spermatogenesis time course (MG-U74A)

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL81, 104440_at (ID_REF), GDS401, 53422 (Gene ID), AF073954
DataSet type:
Expression profiling by array, count, 17 samples
18.
Value/Rank Plot

Ybx2 - Various tissues

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL1261, 1420762_a_at (ID_REF), GDS3142, 53422 (Gene ID), NM_016875
DataSet type:
Expression profiling by array, count, 70 samples
19.
Value/Rank Plot

Ybx2 - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL4053, 1953 (ID_REF), GDS2923, NM_016875
DataSet type:
Expression profiling by array, count, 10 samples
20.
Value/Rank Plot

Ybx2 - Diet-induced obesity model: white adipose tissue

Annotation:
Ybx2, Y box protein 2
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_3086192 (ID_REF), GDS6247, NM_016875, YBX2 (ORF)
DataSet type:
Expression profiling by array, transformed count, 40 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Profile pathways

Find pathways help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center