Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1632

1.
Value/Rank Plot

Dct - Diabetic db/db heart response to rosiglitazone

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL4134, 17054 (ID_REF), GDS4990, NM_010024, A_51_P116838 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 15 samples
2.
Value/Rank Plot

Dct - Light-induced retinal damage

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL6246, 10422249 (ID_REF), GDS4980, NM_010024, AK033040, BC067064, BC082330, EU554632, chr14:118012790-118052185 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 16 samples
3.
Value/Rank Plot

Dct - Interstrain differences in the liver effects of trichloroethylene

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P116838 (ID_REF), GDS3890, NM_010024, A_51_P116838 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 94 samples
4.
Value/Rank Plot

Dct - Matricellular glycoprotein SPARC deficiency effect on lens epithelium

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS3636, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 7 samples
5.
Value/Rank Plot

Dct - Isoproterenol-induced cardiomyopathy and exercise-induced cardiac hypertrophy

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS3596, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, transformed count, 9 samples
6.
Value/Rank Plot

Dct - Liver response to a high cholesterol diet and phenobarbital

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL339, 1418028_at (ID_REF), GDS3103, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, transformed count, 12 samples
7.
Value/Rank Plot

Dct - TGF-beta overexpression effect on the cornea

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS2974, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 8 samples
8.
Value/Rank Plot

Dct - Notch1 deficiency effect on hair follicles

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS2848, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 6 samples
9.
Value/Rank Plot

Dct - Myocilin over-secretion effect on the retina

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS1640, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 4 samples
10.
Value/Rank Plot

Dct - Hair follicle and skin molecular signatures

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL339, 1418028_at (ID_REF), GDS1323, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 10 samples
11.
Value/Rank Plot

Dct - Normal liver developmental stages: embryonic and postnatal

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P116838 (ID_REF), GDS5818, NM_010024, A_51_P116838 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 11 samples
12.
Value/Rank Plot

Dct - Skin response to injury: time course

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS5239, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, transformed count, 24 samples
13.
Value/Rank Plot

Dct - Transcription factor Nrf2 gain-of-function model: postnatal day 2.5 whole skin

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS4498, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 6 samples
14.
Value/Rank Plot

Dct - Various normal tissues

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS3052, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 17 samples
15.
Value/Rank Plot

Dct - Age-related hearing loss model: cochlea

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL339, 1418028_at (ID_REF), GDS3028, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, count, 6 samples
16.
Value/Rank Plot

Dct - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS1647, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, transformed count, 18 samples
17.
Value/Rank Plot

Dct - Obesity and type 2 diabetes: role of adipogenic gene expression (Mu11K-B)

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL76, X63349_s_at (ID_REF), GDS1456, X63349
DataSet type:
Expression profiling by array, count, 11 samples
18.
Value/Rank Plot

Dct - MPSS transcriptome analysis project

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1010, GATCTGTCAGAGGAAGAAGC (ID_REF), GDS868, BC067064
DataSet type:
Expression profiling by MPSS, count, 87 samples
19.
Value/Rank Plot

Dct - CD8 T cell development (Mu11K-B)

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL76, X63349_s_at (ID_REF), GDS755, X63349
DataSet type:
Expression profiling by array, count, 2 samples
20.
Value/Rank Plot

Dct - Various central nervous system regions of adult inbred strain

Annotation:
Dct, dopachrome tautomerase
Organism:
Mus musculus
Reporter:
GPL1261, 1418028_at (ID_REF), GDS3917, 13190 (Gene ID), NM_010024
DataSet type:
Expression profiling by array, transformed count, 102 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center