AK076889 - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 20 of 28

<< First< Prev

Page of 2

Next >Last >>

Select item 1226865481.

Pbdc1 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5343, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122686548

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1188466482.

Pbdc1 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: cerebellum

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5241, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118846648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 518006323.

Pbdc1 - Interleukin-22 effect on colon cultures

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL2872, 12532 (ID_REF), GDS3226, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51800632

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1284812484.

Pbdc1 - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5612, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128481248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153403435.

Pbdc1 - Glucocorticoid effect on the female liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL4134, 42643 (ID_REF), GDS5036, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115340343

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1323331486.

Pbdc1 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS6016, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132333148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152937437.

Pbdc1 - Glucocorticoid effect on the male liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL4134, 42643 (ID_REF), GDS5035, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115293743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640662488.

Pbdc1 - SIRT1 deficiency effect on the liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS3666, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64066248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1284386489.

Pbdc1 - Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5611, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128438648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11826764810.

Pbdc1 - Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5228, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118267648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12093234811.

Pbdc1 - T helper type 9 cells

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5291, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120932348

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7508124812.

Pbdc1 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS3986, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75081248

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3188693213.

Pbdc1 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL2872, 12532 (ID_REF), GDS2413, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31886932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5295893214.

Pbdc1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL2872, 12532 (ID_REF), GDS3259, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52958932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12915554815.

Pbdc1 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5629, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129155548

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12231994316.

Pbdc1 - Industrial pollution effect on liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 42643 (ID_REF), GDS5331, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122319943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13046384817.

Pbdc1 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5666, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130463848

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763245318.

Pbdc1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTACTTACGATTTCTTC (ID_REF), GDS878, AK076889

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7632453

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 10925254319.

Pbdc1 - Diabetic db/db heart response to rosiglitazone

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL4134, 42643 (ID_REF), GDS4990, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109252543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11941974820.

Pbdc1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Pbdc1, polysaccharide biosynthesis domain containing 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P593861 (ID_REF), GDS5258, AK076889, A_52_P593861 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119419748

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Search details

Important Links

Recent activity

Clear Turn Off Turn On

AK076889 (28)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Search results

Items: 1 to 20 of 28

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Search details

Important Links

Recent activity