AK032266 - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 11

Select item 61439671.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6143967

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61501472.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6150147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61555793.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6155579

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76226234.

Chd9 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAAACTCAGCAATAAT (ID_REF), GDS878, AK032266

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7622623

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44596475.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4459647

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44650796.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4465079

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44534677.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4453467

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44829478.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4482947

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44767679.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4476767

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448837910.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4488379

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748492311.

Chd9 - MPSS transcriptome analysis project

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAAACTCAGCAATAAT (ID_REF), GDS868, AK032266

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7484923

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Search details

Important Links

Recent activity

Clear Turn Off Turn On

AK032266 (11)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Search results

Items: 11

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Search details

Important Links

Recent activity