 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 18, 2013 |
| Title |
Whole Genome Shotgun Bisulfite Sequencing of Lung Cells from Human STL002; methylC-seq_STL002LG-01a |
| Sample type |
SRA |
| |
|
| Source name |
Lung tissue; methylC-seq_STL002LG-01a
|
| Organism |
Homo sapiens |
| Characteristics |
sample alias: STL002LG-01 sample common name: Lung molecule: genomic DNA disease: iron deficiency, bipolar biomaterial_provider: Shin Lin, Stanford University biomaterial_type: Primary Tissue tissue_type: Lung tissue_depot: N/A collection_method: Autopsy donor_id: STL002 donor_age: 30 donor_health_status: iron deficiency, bipolar disease (NO diabetes, hypertension, coronary artery disease, cancer) donor_sex: Female donor_ethnicity: Caucasian experiment_type: DNA Methylation extraction_protocol: Qiagen DNeasy mini kit, performed as per manufacturer's instructions extraction_protocol_type_of_sonicator: Covaris S2 extraction_protocol_sonication_cycles: Standard fragment express, 6 cycles dna_preparation_initial_dna_qnty: 5 µg dna_preparation_fragment_size_range: 100-150 dna_preparation_adaptor_sequence: A: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, B: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT dna_preparation_adaptor_ligation_protocol: 16degC for 16 hours with T4 DNA ligase (New England Biolabs) dna_preparation_post-ligation_fragment_size_selection: Two rounds of purification with AMPure XP beads (Agencourt) bisulfite_conversion_protocol: Invitrogen MethylCode bisulfite_conversion_percent: 99.5% of cytosines converted based on shotgun sequencing of unmethylated lambda phage control spiked into original genomic DNA sample library_generation_pcr_template_conc: >The adapter-ligated, bisulfite converted DNA was used in a 50 µl PCR reaction library_generation_pcr_polymerase_type: Stratagene Pfu Turbo Cx library_generation_pcr_thermocycling_program: 95degC 2 min; 98degC 30 sec, 4 cycles of 98degC 15 sec, 60degC 30 sec, 72degC 4 min; 72degC 10 min library_generation_pcr_number_cycles: 8 library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT library_generation_pcr_primer_conc: 25 µM library_generation_pcr_product_isolation_protocol: Two rounds of purification with AMPure XP beads (Agencourt)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Library construction protocol: Five µg of genomic DNA was extracted from frozen cell pellets using the DNeasy Mini Kit (Qiagen, Valencia, CA) and spiked with 25 ng unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI). The DNA was fragmented with a Covaris S2 (Covaris, Woburn, MA) to 100-150 bp, followed by end repair and addition of a 3'A base. Cytosine-methylated adapters provided by Illumina (Illumina, San Diego, CA) were ligated to the sonicated DNA at 16degC for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated DNA was isolated by two rounds of purification with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA). Adapter-ligated DNA (450 ng) was subjected to sodium bisulfite conversion using the MethylCode kit (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. The bisulfite-converted, adapter-ligated DNA molecules were enriched by 4 cycles of PCR with the following reaction composition: 2.5 U of uracil-insensitive PfuTurboCx Hotstart DNA polymerase (Stratagene), 5 µl 10X PfuTurbo reaction buffer, 31 µM dNTPs, 1 µl Primer 1, 1 µl Primer 2 (50 µl final). The thermocycling parameters were: 95degC 2 min, 98degC 30 sec, then 4-8 cycles of 98degC 15 sec, 60degC 30 sec and 72degC 4 min, ending with one 72degC 10 min step. The reaction products were purified using AMPure XP beads (two rounds). Up to three separate PCR reactions were performed on subsets of the adapter-ligated, bisulfite-converted DNA, yielding up to two independent libraries from the same biological sample.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
sample_term_id: UBERON_0002048 assay_term_id: OBI_0001863 nucleic_acid_term_id: SO_0000352 Design description: Whole Genome Shotgun Bisulfite Sequencing of Lung Cells from Human STL002 Library name: methylC-seq_STL002LG-01a EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.13683 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.12247 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
| Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM983647_UCSD.Lung.Bisulfite-Seq.STL002.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: methylC-seq_STL002LG-01a.hg19.level.2.release.9 ANALYSIS TITLE: Methylation Proportion Graphs of Lung Bisulfite-Seq Data ANALYSIS DESCRIPTION: Illumina Bisulfite-Seq read mappings from Lung, Donor STL002 were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads. Reads from the + and - strands were combined for methylation proportion calculations. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.18764 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: Bisulfite-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: If multiple reads map to the same start position on the + strand or stop position on the - strand, only a single read is retained. GENOMIC_WINDOW: 2bp containing CpGs TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 9 BROWSER_TRACK_NAME: Lung BS 02 BROWSER_TRACK_DESCRIPTION: UCSD Lung Bisulfite-Seq Donor STL002 EA Release 9
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 1,523,404,047 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 99.2 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS_PERCENTILE: 51 MAXIMUM_REPLICATE_CORRELATION: NA
**********************************************************************
|
| |
|
| Submission date |
Aug 09, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
UCSD AND SALK |
| Organization name |
University of California, San Diego
|
| Street address |
Health Sciences Drive
|
| City |
La Jolla |
| State/province |
CA |
| ZIP/Postal code |
92092 |
| Country |
USA |
| |
|
| Platform ID |
GPL9115 |
| Series (1) |
| GSE16256 |
UCSD Human Reference Epigenome Mapping Project |
|
| Relations |
| SRA |
SRX175350 |
| BioSample |
SAMN00849926 |
| Named Annotation |
GSM983647_UCSD.Lung.Bisulfite-Seq.STL002.wig.gz |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM983647_UCSD.Lung.Bisulfite-Seq.STL002.wig.gz |
223.8 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data not provided for this record |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |