 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 03, 2013 |
| Title |
Sigma_TLSeq |
| Sample type |
SRA |
| |
|
| Source name |
Sigma_TLSeq
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: Sigma 1278b
rna subtype: RNA
|
| Treatment protocol |
Total RNA was isolated from yeast cell pellets by hot phenol extraction as described (Clarkson et al., 2010). Polysome gradients were prepared and RNA was extracted from gradient fractions as described (Arribere et al., 2011).
|
| Growth protocol |
Yeast cultures (Sigma 1278b MAT a ura3 leu2 trp1 his3 and BY4742 Mat α his3∆1 leu2∆0 lys2∆0 ura3∆0) were grown to mid-log (OD600~0.5-1.0) phase in YPAD (1% yeast extract, 2% peptone, 0.01% adenine hemisulfate, 2% glucose) at 30°C in flasks with vigorous shaking.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
200-1000 µg RNA was subjected to poly(A) selection using oligo dT cellulose as described previously (Sambrook et al.). Poly(A)-selected RNA was fragmented by alkaline hydrolysis (2 mM EDTA, 100mM NaCO3, pH 9.3) for one hour at 95°C. RNA fragments were gel purified and dephosphorylated with 30 U Calf-Intestinal Phosphatase (CIP, NEB) in 50 ml reactions containing 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1mM DTT, pH 7.9 at 37°C for 60 min, followed by phenol:chloroform extraction and isopropanol precipitation. Purified CIP-treated fragments were treated (or mock-treated) with 25 U Tobacco Acid Pyrophosphatase (TAP, Epicentre) in 50 ml at 37°C for two hours, then precipitated. Next a 5’RNA adaptor (AAUGAUACGGCGACCACCGACAGGUUCAGAGUUCUACAGUCCGACG) was added via ligation in a 20 ml reaction with 20 U of T4 RNA Ligase (NEB) for one hour at 37°C. Gel purification of a higher molecular weight species yielded the ligated RNA, which was then 3’end captured via poly(A) tailing (TL-Seq, as previously described in (Ingolia et al., 2009)) or ligation with preadenylated adaptor (TATL-Seq, as previously described in (Mayr and Bartel, 2009)). cDNA was prepared from ligated RNA (Superscript III, Invitrogen), amplified by 10-12 cycles of PCR (Phusion, Finnzymes), and sequenced on an Illumina Genome Analyzer II.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
TL-Seq, +pyrosphosphatase
|
| Data processing |
TATL-SeqCombined.wig is TATL-SeqFraction1.wig through TATL-SeqFraction7.wig computationally pooled reads (simply the sum of all the other read densities). Each file is the read abundance at each position of the sacCer3 genome. Reads were mapped to the genome, then annotated splice junctions allowing for 3 mismatches (just as in the associated paper).
Library strategy: TL-Seq
Reads mapped to genome with Bowtie.
Reads assigned to genes. Intergenic reads were assigned to the closest gene, regardless of strand. Antisense reads were ignored for subsequent analyses.
Peaks were called assuming a uniform background distribution, using Poisson distribution to identify regions of high read density.
Genome Build: sacCer3
Supplementary_files_format_and_content: Tab-delimited file of monopeak TL genes giving TL length
|
| |
|
| Submission date |
Jul 03, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Joshua A Arribere |
| E-mail(s) |
arribere@mit.edu
|
| Phone |
6172533707
|
| Organization name |
MIT
|
| Department |
Biology
|
| Lab |
Gilbert
|
| Street address |
31 Ames St
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02141 |
| Country |
USA |
| |
|
| Platform ID |
GPL9377 |
| Series (1) |
| GSE39074 |
Roles for Transcript Leaders in Translation and mRNA Decay Revealed by Transcript Leader Sequencing |
|
| Relations |
| SRA |
SRX157543 |
| BioSample |
SAMN01085406 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM955198_TL-SeqPlusTAP.wig.gz |
1012.2 Kb |
(ftp)(http) |
WIG |
| GSM955198_TLSeq_withPyroLengthCalls.txt.gz |
8.5 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
