 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 23, 2012 |
| Title |
rat vascular smooth muscle cells stimulated with Ang II for 3h |
| Sample type |
SRA |
| |
|
| Source name |
vascular smooth muscle cells, Ang II stimulation for 3h
|
| Organism |
Rattus norvegicus |
| Characteristics |
strain: Sprague-Dawley
tissue: aorta
|
| Treatment protocol |
serum depleted for 48h and treated with or without Ang II (100nM) for 1h, 3h or 24h.
|
| Growth protocol |
rat vascular smooth muscle cells were cultured in M199 medium supplemented with 10% FBS.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was used for the construction of small RNA libraries, cluster generation, and then deep sequencing (at the Beckman Research Institute Sequencing Core), using the Alternative v1.5 Protocol (Illumina Inc., San Diego, CA) with minor optimization. Briefly, 0.5 μg of total RNA was ligated to sRNA 3’adapter (AUCUCGUAUGCCGUCUUCUGCUUG) using T4 RNA Ligase 2, truncated (New England BioLabs, Ipswich, MA) at 22 °C for 1 h, and subsequently ligated to the SRA 5’adapter (GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase (New England BioLabs, Ipswich, MA) at 20 °C for 1 h. The adaptor-linked RNA was converted to single-stranded cDNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and RT-Primer (5’-CAAGCAGAAGACGGCATACGA-3’), and then amplified with Phusion DNA Polymerase (Finnzymes Thermo Scientific, Pittsburgh, PA) for 12 cycles using primers (5’-CAAGCAGAAGACG GCATACGA-3’; 5’-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3’). PAGE purification was carried out to select small RNAs of 17-52 nucleotides in length. The purified library was quantified using qPCR, used for cluster generation on cBot, and sequenced using Genome Analyzer IIx (Illumina Inc. San Diego, CA).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
small RNA separated from total RNA
|
| Data processing |
Raw data in FASTQ format generated from the Illumina pipeline was aligned against Rat Nov. 2004 (rn4) assembly using Novoalign software (http://www.novocraft.com). The 3’-adapter was trimmed by Novoalign before the alignment, and reads shorter than 16-base after adapter trimming were discarded. For reads aligned to multiple locations on the genome, one aligned region was randomly selected for counting the number of reads (Supplemental Table S1) as described (18). Genomic locus of each rat mature microRNA (miRNA) was generated by aligning rat mature miRNA sequences (miRBase v14) to rn4 assembly without allowing mismatches. For each sample, an aligned read was annotated to a specific genome feature in the order of mature miRNA, miRNA precursor, rRNA, tRNA, other ncRNA, Refseq gene and intergenic region if it completely falls in the specified region with 10 bp extension on both ends. Specifically, aligned reads were first annotated to rat mature miRNA (v14, www.miRbase.org) genomic loci. The reads that could not be annotated to mature miRNA regions were processed further to annotated pre-miRNA genomic regions (v14). Remaining reads were then annotated to non-coding RNAs (ncRNAs) other than miRNAs including rRNA and tRNA, using rat ncRNA annotation file downloaded from UCSC genome browser (http://genome.ucsc.edu/). Finally, the reads that were not annotated to any ncRNA regions were assigned to Refseq genes and the remaining reads were defined as intergenic regions. For each sample, the reads corresponding to the mature miRNA genomic loci (including 10-base extension on both ends) were counted to obtain expression levels of total miRNAs (Supplemental Table S2).The resulting miRNA expression dataset was further normalized by scaling the total mature miRNA counts in each sample to 8.5 million. Differentially expressed miRNAs induced by Ang II at indicated time points were selected using the criteria; a) reads in at least one sample were above 256, and b) showed at least 1.5 fold change between Ang II-treated samples versus untreated.
Genome Build:
AngII_3h_uniq_seq_count_filtered.txt: rn4
|
| |
|
| Submission date |
Feb 09, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Nancy Chen |
| E-mail(s) |
zhuchen@coh.org
|
| Organization name |
City of Hope
|
| Department |
Diabetes
|
| Street address |
1500 Duarte Road
|
| City |
Duarte |
| State/province |
CA |
| ZIP/Postal code |
91010 |
| Country |
USA |
| |
|
| Platform ID |
GPL10669 |
| Series (1) |
| GSE35664 |
High-throughput sequencing of endogenous small RNAs from rat vascular smooth muscle cells with and without Angiotensin II stimulation |
|
| Relations |
| SRA |
SRX119335 |
| BioSample |
SAMN00784006 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM873210_AngII_3h_uniq_seq_count_filtered.txt.gz |
3.4 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
