NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM8484503 Query DataSets for GSM8484503
Status Public on Aug 28, 2024
Title RNA_FL_timecourse_E10.5+C59+1h_rep1
Sample type SRA
 
Source name Forelimb bud
Organism Mus musculus
Characteristics tissue: Forelimb bud
genotype: WT Swiss Albino
treatment: C59
timepoint of_treatment: E10.5
timepoint of_dissection: E10.5 + 1hour
Extracted molecule polyA RNA
Extraction protocol Limb buds were dissected in ice-cold PBS, washed in PBS, transferred to RNAlater (Invitrogen), and stored overnight at -20°C. The next day, samples were transferred to -80°C for long-term storage. RNA isolation was performed with the RNeasy Kit (Qiagen) following manufacture instructions. After performing QC on a Fragment Analyzer (Advanced Analytical Technologies, Inc.), RNA was stored at -80 until shipping to Novogene.
Library constructions and sequencing were performed at Novogene.
Standard Illumina mRNA-libraries (by polyA-enrichment) were made and after successful QC sequenced. Libraries were sequenced as PE150 on a NovaSeq6000 (by Novogene)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Data processing Low quality bases and Truseq adapters were removed with cutadapt v1.16 (-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 30 -m 15)
Reads were mapped on mm10 with STAR version 2.7.0e using ENCODE parameters using custom gtf https://doi.org/10.5281/zenodo.7510406, counts and coverage were computed at the same time.
FPKM values were computed with cufflinks version 2.2.1 (--max-bundle-length 10000000 --multi-read-correct --library-type "fr-unstranded" -b /home/ldelisle/genomes/fasta/mm10.fa --no-effective-length-correction -M MTmouse.gtf -G custom.gtf)
Average coverage between replicates was computed with bigwigAverage from deepTools version 3.5.5
Assembly: mm10
Supplementary files format and content: bw: normalized coverage on uniquely mapped reads
Supplementary files format and content: AllCufflinks_Simplified_timecourse.txt.gz: table with all FPKM values (one row per ensembl id, one column per sample)
Supplementary files format and content: AllHTSeqCounts_subset_timecourse.txt.gz: table with all count values obtained with STAR (one row per ensembl id, one column per sample, genes on chrX, Y, M were removed)
 
Submission date Aug 27, 2024
Last update date Aug 30, 2024
Contact name Lucille Lopez-Delisle
E-mail(s) lucille.delisle@epfl.ch
Organization name EPFL
Street address Station 19
City Lausanne
ZIP/Postal code 1015
Country Switzerland
 
Platform ID GPL24247
Series (2)
GSE275783 Synchronization of growth and self-organizing digit pattern by WNT signaling [RNAseq]
GSE275784 Synchronization of growth and self-organizing digit pattern by WNT signaling
Relations
BioSample SAMN43383087
SRA SRX25842459

Supplementary file Size Download File type/resource
GSM8484503_RNA_FL_timecourse_E10.5+C59+1h_rep1_Uniq_norm.bw 129.2 Mb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap