 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 18, 2024 |
| Title |
CTCF CUT&RUN of HoxB Del/Del(i9-13):Ins(CBS5-10):Inv(CBS5-10):Del(CBS7-10) mESC |
| Sample type |
SRA |
| |
|
| Source name |
mESC
|
| Organism |
Mus musculus |
| Characteristics |
cell line: mESC
antibody: CTCF (61311, Active Motif)
genotype: HoxB Del/Del(i9-13):Ins(CBS5-10):Inv(CBS5-10):Del(CBS7-10)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Each ESC per genotype were washed into fresh PBS before dissociation. The dissociation was performed in 0.5mL StemPro Accutase (Gibco A1110501), 5min at 37°C. Cells were resuspended into 2mL of ESC media and span at 300g for 2min.
Then, 0.5x106 cells were processed according to the CUT&RUN protocol55. First, cells were resuspended into 1mL of Wash Buffer (WB: 20mM HEPES-KOH pH7.5, 150 mM NaCl, 0.5mM Spermidin (Sigma S2626)) and bound to Concanavalin A-coated beads (BioMagPlus 86057) into Digitonin Wash Buffer (DWB) using a final concentration of 0.02% digitonin (Apollo APOBID3301) into WB. Second, cells were incubated with 0.5µg/100μl of anti-CTCF antibody (Active Motif 61311) in DWB at 4°C for 2hr. The pA-MNase was produce by the Protein Production and Structure Core Facility at EPFL and added at 0.5 μl/100 μl in Digitonin Wash Buffer for 1hr at 4°C. Third, cells were digested in Low Calcium Buffer (100mM CaCl2 into DWB). Reaction was stopped using cold 2X STOP Buffer (340mM NaCl, 4mM EGTA, 20mM EDTA, 0.02% Digitonin, 50µg RNase A (10mg/mL), 50µG Glycogen (5mg/mL)) for 5min. Finally, targeted chromatin was released for 30 min at 37 °C, then precipitated into 70% EtOH and stored at -20°C until sequencing libraries generation. Sequencing libraries were prepared with KAPA HyperPrep reagents (07962347001) with 2.5µl of adapters at 0.3µM and ligated for 1 h at 20 °C. Then, DNA was cleaned and size selected using 1:1 ratio of DNA:Ampure SPRI beads (A63881) followed by an additional 1:1 wash and size selection with HXB. The DNA was amplified for 16 cycles. Post-amplified DNA was cleaned and size selected using 1:1 ratio followed by an additional 1:1 wash and size selection with HXB. HXB is equal parts 40% PEG8000 (Fisher FIBBP233) and 5 M NaCl.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Adapter and bad quality bases were removed from fastq files using cutadapt version 4.1 (Martin, 2011)(-a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-q 30 -m 15).
Filtered reads were aligned on the in silico mutant genome using bowtie2 version 2.4.5 (Langmead & Salzberg, 2012)with adapted parameters (--very-sensitive --no-unal --no-mixed --no-discordant --dovetail -X 1000).
No filtering for mutlimap reads was performed as sequences are duplicated between both alleles of chromosome 11.
PCR duplicates were removed with Picard MarkDuplicates version 2.27.4 (Broad Institute).
Filtered BAM file was converted to BED with BEDTools version 2.30.0 (Quinlan & Hall, 2010).
Coverage was computed with macs2 version 2.2.7.1 (Zhang et al, 2008) (--nomodel --keep-dup all --shift -100 --extsize 200 --call-summits -B) and then normalized to the million reads in peaks.
Assembly: mm10_HoxB_deli9-13insCBS5-10_del
Supplementary files format and content: *bw = coverage normalized to million reads in peaks
Supplementary files format and content: *narrowPeak.gz = peak obtained by macs2
Library strategy: CUT&RUN
|
| |
|
| Submission date |
Jul 16, 2024 |
| Last update date |
Jul 18, 2024 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE272379 |
CTCF-dependent insulation of Hoxb13 and the heterochronic control of tail length [CUT&RUN] |
| GSE272483 |
CTCF-dependent insulation of Hoxb13 and the heterochronic control of tail length |
|
| Relations |
| BioSample |
SAMN42535851 |
| SRA |
SRX25346494 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8399683_CUTnRUN_CTCF_delBinv5-10del7-10_mESC_onmm10_HoxB_deli9-13insCBS5-10_del.bw |
147.1 Mb |
(ftp)(http) |
BW |
| GSM8399683_CUTnRUN_CTCF_delBinv5-10del7-10_mESC_onmm10_HoxB_deli9-13insCBS5-10_del.narrowPeak.gz |
2.4 Mb |
(ftp)(http) |
NARROWPEAK |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
