NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM8387507 Query DataSets for GSM8387507
Status Public on Sep 30, 2024
Title 83_MO_10uM_rep2_24h
Sample type SRA
 
Source name kidney
Organism Mesocricetus auratus
Characteristics tissue: kidney
cell line: BHK-21
cell type: fibroblast cells
genotype: repRNA-v4 based
treatment: molnupiravir
Treatment protocol After 24 hours of electroporation, cells were subjected to continuous puromycin treatment (10 µg/ml) with regular passages. After another 5-7 days, a relatively stable and homogeneous population of cells carrying replicative RNA with EGFP expression was generated. These cells were then treated with nucleoside analogues at specified concentrations and durations.
Growth protocol BHK-21 cells were cultivated in Minimum Essential Medium with Earle's Balanced Salts (MEM/EBSS) supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/ml streptomycin, and 1% MEM Non-Essential Amino Acids Solution (Gibco, #11140050) in a humidified 37℃ incubator with 5% CO2.
Extracted molecule total RNA
Extraction protocol The cells were harvested, and total RNA was extracted using TRIzol™ Reagent (Thermo Fisher Scientific, #15596018). Subsequently, approximately 3 μg of total RNA was reverse transcribed using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, #R312-02) with a primer (SINDBIS_GSPR2: TGCGCCTCCTCGGAAATACG) located in the 3′ untranslated region of the replicative RNA.
EGFP region was amplified from the cDNA samples via 28 rounds of PCR using KOD OneTM PCR Master Mix and specific primers(For a 50 μl PCR reaction, 5 μl cDNA was used as template). The PCR product was purified using the HiPure Gel Pure DNA Micro Kit (Magen, #D2110-03). The gel-purified PCR product (approximately 1 μg) was subjected to sequencing using Tsingke Biotechnology's Fast NGS service. In brief, the experimental workflow provided by Tsingke Biotechnology involved the following steps: Firstly, DNA was enzymatically digested using Tn5 with sequence adaptors. Secondly, the digested products were subjected to PCR amplification using indexed sequencing primers. Finally, the resulting PCR products were recovered and subjected to sequencing using an Illumina MiSeq platform, ensuring a sequencing depth exceeding 500× on the target gene for accurate estimation of mutation frequency.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
 
Data processing Trimmomatic 0.39 was used to remove the 5' end 15-bp low quality sequence of the FASTQ file. BWA 0.7.17-r1188 was employed to map the resulting cleaned reads to the reference sequence. The resulting bam files were processed using a command mpileup from samtools to generate bcf file. To precisely profile the mutational frequency, nucleotides with sequencing quality score below Q30 were discarded. Then, custom Bash and Python scripts were used to extract the mutation information and calculate the mutation frequency. The mutation frequency at each specific position within the target gene is calculated by dividing the number of mutated bases (transversion and transition) at that position by the total number of bases sequenced at the specific position.
Assembly: Coding sequence of EGFP
Supplementary files format and content: The processed files in csv format contain the total mutation frequency for each sample.
 
Submission date Jul 09, 2024
Last update date Sep 30, 2024
Contact name Yihan Lin
E-mail(s) yihan.lin@pku.edu.cn
Organization name Peking University
Street address No.5 Yiheyuan Road, Haidian
City Beijing
ZIP/Postal code 10087
Country China
 
Platform ID GPL29575
Series (1)
GSE271881 Quantification of induced RNA mutation by nucleoside analogs in the repRNA-v4 EGFP region
Relations
BioSample SAMN42389784
SRA SRX25260663

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap