|
| Status |
Public on May 29, 2024 |
| Title |
Muscle, Icos-/- NOD, CD45+, INF [1_3|003|CD45+] |
| Sample type |
SRA |
| |
|
| Source name |
Muscle (quadriceps)
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Muscle (quadriceps)
strain: Icos-/- NOD
slide id: 1_3
roi number: 3
segment type: CD45+
area: 114463.8
nuclei_counts: 1691
roi x coordinate: 20171.6
roi y coordinate: 70303.8
characteristic: rawreads: 99462714
characteristic: alignedreads: 95174271
characteristic: deduplicatedreads: 1179662
characteristic: trimmedreads: 99041987
characteristic: stitchedreads: 97826215
characteristic: sequencingsaturation: 98.8
|
| Treatment protocol |
Animals were reared on a 12-hour light-dark cycle and had ad-libitum access to food and water.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Tissues were frozen in chilled in liquid nitrogen for ~ 1,5 min. Six-micrometer-thick cryosections were prepared using the GeoMx Digital Spatial Profiler (DSP) Whole Transcriptome Atlas (WTA) slide prep protocol from NanoString Technologies. Sections were incubated with(WTA RNA-ISH probes conjugated with UV-photocleavable linkers following standard ISH protocols. Entire slides containing Icos+/+ NOD and Icos-/- NOD sections were imaged at ×20 magnification, and Regions of Interest (ROIs) (4 Icos+/+ NOD and 14 Icos-/- NOD) were selected. The GeoMx DSP segmentation tool allowed the separation of different areas of illumination (AOI) on the basis of morphology markers (CD45 and desmin). This strategy allowed the analysis of RNA expression from myofibers (CD45-desmin+) from Icos+/+ NOD (n=4) and from Icos-/- NOD mice, the latter being non-adjacent (designated as “Icos-/- NOD mice PROX”) (n=6) or adjacent (designated as “Icos-/- NOD mice ADJ”) (n=8) to immune cell infiltrate clusters (CD45+desmin-). Regions of interest within the tissue were exposed to UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. DSP protocol detailed information can be found in Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x).
Each collection of oligo tags from one well (corresponding to an AOI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified by AMPure XP PCR purification. Pooled libraries were sequenced at 2 × 27 base pairs and with the dual-indexing workflow on an Illumina NovaSeq 6000.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
FASTQ files were converted into digital count conversion (DCC) and STATS files using GeoMx NGS Pipeline
DCC files were uploaded to the GeoMx DSP to generate the initial, spatially resolved, dataset
Gene counts were mapped to specific ROIs and normalized using Q3 normalization strategy in keeping with NanoString GeoMx recommendations. (https://nanostring.com/resources/introduction-to-geomx-normalization-cta-whitepaper/)
dcc-metadata = false
save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
Assembly: Other: See Mm_R_NGS_WTA_v1.0.pkc Supplementary file
Supplementary files format and content: DCC
Library strategy: Spatial Transcriptomics
|
| |
|
| Submission date |
Mar 25, 2024 |
| Last update date |
May 29, 2024 |
| Contact name |
Catalina Abad |
| E-mail(s) |
catalina.abad@inserm.fr
|
| Organization name |
Inserm U1234
|
| Street address |
22 Blvd Gambetta
|
| City |
Rouen |
| ZIP/Postal code |
76000 |
| Country |
France |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE262352 |
Spatial transcriptome analysis of muscle sections from Icos-/- NOD mice with established myositis |
|
| Relations |
| BioSample |
SAMN40597800 |
| SRA |
SRX24039385 |
