 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 23, 2012 |
| Title |
ABAB817_8WG16_N2_LTEMB extraction1_array1 channel_1 |
| Sample type |
genomic |
| |
|
| Channel 1 |
| Source name |
ABAB817_8WG16_N2_LTEMB extraction1_array1 channel_1
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: N2
developmental stage: Late Embryos
genotype: wild type
Sex: Hermaphrodite
|
| Growth protocol |
Worm_embryo_growth_and_harvest_vRG1. Synchronized worm cultures were grown at 20 °C in batches of 500 ml using 2.8-L Fernbach flasks shaking at 230 rpm. Gravid adults were separated from debris by sucrose floating. Embryos were isolated by bleaching and fixed after chitinase treatment with 1 % formaldehyde for 10 min on ice. For a detailed protocol see http://www.modencode.org/.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Worm_embryo_extraction_vRG1. Fixed embryos were suspended in 5 volumes of ChIP buffer (50 mM Hepes-KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) and sonicated on ice with a Branson sonifier microtip (30 % power setting for 3 min; 40 % power setting for 1 min). Debris were pelleted at 10 000 g for 20 min and the supernatant was made 10 % in glycerol. The extract was snap frozen in liquid nitrogen aliquots containing 3 mg of protein and stored at ? 80 °C.
Worm_chromatin_immunoprecipitation_vRG1. For each ChIP reaction, 3 mg of protein extract was diluted with ChIP buffer (50 mM Hepes KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) to 900 ?l. Then 35 ?l 30 % sarcosyl (1 % final) and 20 ?l 5 % Na-deoxycholate (0.1 % final) were added. 50 ?l of the diluted extract were removed (input sample), mixed with Elution buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM NaCl, 1 % SDS) and processed as described for ChIP samples. 100 ?l antibody/bead suspension (5?g antibody pre-bound to 50 ?l Dynabeads, suspended in ChIP buffer) was added and the mixture and rotated over night at 4 °C. Beads were washed with 2 × 1 ml FA Buffer (50 mM Hepes-KOH pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 5 min each; with 1 ml FA-1000 buffer (50 mM Hepes-KOH pH 7.6, 1 M NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml FA-500 buffer (50 mM Hepes-KOH pH 7.6, 500 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml TEL buffer (10 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate) for 10 min; and briefly with 1 ml TE buffer (10mM Tris-HCl pH 8.0, 1mM EDTA). Immunocomplexes were eluted with 50 ?l Elution buffer for 15 min at 67 °C. Eluates were incubated over night at 65 °C to reverse cross-links, then treated with proteinase K (0.44 mg/ml) at 37 °C for 2 h. Nucleic acids were recovered by phenol/chloroform extraction and ethanol precipitation. After digestion with RNAse A (0.33 mg/ml) for 2h at 37 °C, DNA was purified using the Qiagen PCR purification kit.
Worm_LM-PCR_Amplification_for_ChIP-chip_vRG1. ChIP and input DNA was blunt ended with T4 polymerase for 20 min at 12 °C and purified by phenol/chloroform extraction and EtOH precipitation. Annealed oligonucleotide linkers (oligo 1: gcggtgacccgggagatctgaattc; oligo 2: gaattcagatc) were ligated to the DNA fragments over night at 16 °C. The ligated DNA was precipitated with EtOH, disolved in 10 mM Tris-HCl pH 8, and amplified with a Taq/Pfu polymerase mix using oligo 1. For a detailed protocol see http://www.modencode.org/.
|
| Label |
Cy3-monofunctional dye(1-)
|
| Label protocol |
ChIP-chip_label_hyb_nimblegen_v1. DNA was labeled and hybridized to C. elegans tiling array by Roche NimbleGen according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, Amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| |
|
| Channel 2 |
| Source name |
ABAB817_8WG16_N2_LTEMB extraction1_array1 channel_2
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: N2
developmental stage: Late Embryos
genotype: wild type
Sex: Hermaphrodite
|
| Growth protocol |
Worm_embryo_growth_and_harvest_vRG1. Synchronized worm cultures were grown at 20 °C in batches of 500 ml using 2.8-L Fernbach flasks shaking at 230 rpm. Gravid adults were separated from debris by sucrose floating. Embryos were isolated by bleaching and fixed after chitinase treatment with 1 % formaldehyde for 10 min on ice. For a detailed protocol see http://www.modencode.org/.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Worm_embryo_extraction_vRG1. Fixed embryos were suspended in 5 volumes of ChIP buffer (50 mM Hepes-KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) and sonicated on ice with a Branson sonifier microtip (30 % power setting for 3 min; 40 % power setting for 1 min). Debris were pelleted at 10 000 g for 20 min and the supernatant was made 10 % in glycerol. The extract was snap frozen in liquid nitrogen aliquots containing 3 mg of protein and stored at ? 80 °C.
Worm_chromatin_immunoprecipitation_vRG1. For each ChIP reaction, 3 mg of protein extract was diluted with ChIP buffer (50 mM Hepes KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) to 900 ?l. Then 35 ?l 30 % sarcosyl (1 % final) and 20 ?l 5 % Na-deoxycholate (0.1 % final) were added. 50 ?l of the diluted extract were removed (input sample), mixed with Elution buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM NaCl, 1 % SDS) and processed as described for ChIP samples. 100 ?l antibody/bead suspension (5?g antibody pre-bound to 50 ?l Dynabeads, suspended in ChIP buffer) was added and the mixture and rotated over night at 4 °C. Beads were washed with 2 × 1 ml FA Buffer (50 mM Hepes-KOH pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 5 min each; with 1 ml FA-1000 buffer (50 mM Hepes-KOH pH 7.6, 1 M NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml FA-500 buffer (50 mM Hepes-KOH pH 7.6, 500 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml TEL buffer (10 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate) for 10 min; and briefly with 1 ml TE buffer (10mM Tris-HCl pH 8.0, 1mM EDTA). Immunocomplexes were eluted with 50 ?l Elution buffer for 15 min at 67 °C. Eluates were incubated over night at 65 °C to reverse cross-links, then treated with proteinase K (0.44 mg/ml) at 37 °C for 2 h. Nucleic acids were recovered by phenol/chloroform extraction and ethanol precipitation. After digestion with RNAse A (0.33 mg/ml) for 2h at 37 °C, DNA was purified using the Qiagen PCR purification kit.
Worm_LM-PCR_Amplification_for_ChIP-chip_vRG1. ChIP and input DNA was blunt ended with T4 polymerase for 20 min at 12 °C and purified by phenol/chloroform extraction and EtOH precipitation. Annealed oligonucleotide linkers (oligo 1: gcggtgacccgggagatctgaattc; oligo 2: gaattcagatc) were ligated to the DNA fragments over night at 16 °C. The ligated DNA was precipitated with EtOH, disolved in 10 mM Tris-HCl pH 8, and amplified with a Taq/Pfu polymerase mix using oligo 1. For a detailed protocol see http://www.modencode.org/.
|
| Label |
Cy5-monofunctional dye(1-)
|
| Label protocol |
ChIP-chip_label_hyb_nimblegen_v1. DNA was labeled and hybridized to C. elegans tiling array by Roche NimbleGen according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, Amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| |
|
| |
| Hybridization protocol |
ChIP-chip_label_hyb_nimblegen_v1. DNA was labeled and hybridized to C. elegans tiling array by Roche NimbleGen according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, Amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42°C.
|
| Scan protocol |
ChIP-chip_scanning_nimblegen_v1. Array scanning and raw data extraction were performed at Roche NimbleGen, according to the protocol described in chapter 5 and 6 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, array signal was scanned by using a GenePix 4000B Scanner with associated software and saved as .tif files of the 532nm and 635nm images individually. Raw signal intensities of the images were extracted and saved as .pair files by using NimbleScan software according to the NimbleScan v2.4 User?s Guide.
|
| Description |
channel ch1 is input DNA;
channel ch2 is ChIP DNA; Antibody information listed below: official name: ABAB817 8WG16:346588;target name: RNA polII CTD domain unphosophorylated;host: Mouse;antigen: Native RNA Polymerase II purified from wheat germ;clonal: Monoclonal;purified: Size;company: Abcam;catalog: ab817;short description: A mouse monoclonal antibody which recognizes primarily the unphosphorylated RNA Pol II CTD (8WG16) was used for ChIP.;
|
| Data processing |
ChIP-chip normalization standard MA2C:JL:2 protocol. ChIP-chip_normalization_standard_MA2C_v2. First, all the IP and INPUT log ratio values are read from the pairdata file. Secondly, we build GC bins for INPUT and IP based on the GC counts for every probe sequence, which means that the INPUT or IP values for any probes which have the same GC counts will be put together. After that, for each GC bin, we calculate the mean for IP and INPUT data, and the covariance between this two channels. By default, the robust mean variance method is applied, which generalizes Tukey's theory of bi-weight estimation where the constant C is set to 2. At last, we adjust the log ratio values for each probe by using the mean and covariance values for their corresponding GC bins, then these values are further normalized by their mean and standard derivation. In a single experiment, median within the sliding window defined by 2x bandwidth parameter is assigned as MA2C score at the center of each probe. In case of replicates, when we calculate the MA2Cscore afterwards, we take the median as the score from all the replicates for all the probes within the sliding window defined by 2x bandwidth parameter. Processed data are obtained using following parameters: genome version is WS190
|
| |
|
| Submission date |
Oct 07, 2011 |
| Last update date |
Feb 02, 2015 |
| Contact name |
DCC modENCODE |
| E-mail(s) |
help@modencode.org
|
| Phone |
416-673-8579
|
| Organization name |
Ontario Institute for Cancer Research
|
| Lab |
modENCODE DCC
|
| Street address |
MaRS Centre, South Tower, 101 College Street, Suite 800
|
| City |
Toronto |
| State/province |
Ontario |
| ZIP/Postal code |
M5G 0A3 |
| Country |
Canada |
| |
|
| Platform ID |
GPL8647 |
| Series (1) |
|
| Relations |
| Named Annotation |
GSM811283_ABAB817_8WG16_N2_LTEMB_1_MA2Cscore.wig.gz |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM811283_ABAB817_8WG16_N2_LTEMB_1_17038101_532.pair.gz |
36.3 Mb |
(ftp)(http) |
PAIR |
| GSM811283_ABAB817_8WG16_N2_LTEMB_1_17038101_635.pair.gz |
35.9 Mb |
(ftp)(http) |
PAIR |
| GSM811283_ABAB817_8WG16_N2_LTEMB_1_MA2Cscore.wig.gz |
9.9 Mb |
(ftp)(http) |
WIG |
| GSM811283_ABAB817_8WG16_N2_LTEMB_1_peaks.gff.gz |
14.8 Kb |
(ftp)(http) |
GFF |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
