|
Status |
Public on Apr 05, 2024 |
Title |
Peripheral blood cells before culture, biol rep 1 |
Sample type |
SRA |
|
|
Source name |
Blood
|
Organism |
Xenopus tropicalis |
Characteristics |
tissue: Blood cell line: Total peripheral blood cells cell type: Blood cells genotype: Wild type treatment: None
|
Treatment protocol |
5,000,000 cells were suspended in 7/9 x IMDM-10% FCS and reacted with 1 ng/mL Xenopus tropicalis EPO expressed in E.coli for 1.5 or 4.0 hours.
|
Growth protocol |
Blood cells were corrected from the heart and mixed with anti-coagulator EDTA-2Na. Cells were washed three times with 7/9 x phosphate buffered serine containing 2 mM EDTA-2Na and 2% fetal calf serum.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted by the acid guanidine phenol-chloroform method. 50 ng of total RNA was used for the construction of sequencing libraries. RNA libraries for RNA-Seq were prepared by Lasy-Seq v1.1 (https://sites.google.com/view/lasy-seq/)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
HiSeq X Ten |
|
|
Description |
101
|
Data processing |
Read 1 reads were processed with fastp (version 0.21.0) 1 using the following parameters: --trim_poly_x -w 20 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -l 31. The trimmed reads were then mapped to the reference transcriptome sequences of X. tropicalis was prepared from the Xenbase v10.0 (https://www.xenbase.org/xenbase/), using BWA mem (version 0.7.17-r1188) 2 with the default parameters. The read count for each gene was calculated with salmon using -l IU, which specifies the library type (version v0.12.0) 3. Then, using R (version 4.3.2) 4, the sums of read counts per gene were calculated. Assembly: UCB_Xtro_10.0 Supplementary files format and content: csv data file includes raw counts for each sample.
|
|
|
Submission date |
Dec 22, 2023 |
Last update date |
Apr 05, 2024 |
Contact name |
Kazuki Omata |
E-mail(s) |
oma_drum.k@moegi.waseda.jp
|
Organization name |
Waseda University
|
Department |
Graduate school of advanced science and engineering
|
Street address |
Wakamatsucho, 2-2
|
City |
Shinjuku |
State/province |
Tokyo |
ZIP/Postal code |
332-0031 |
Country |
Japan |
|
|
Platform ID |
GPL30213 |
Series (1) |
GSE251901 |
Effect of erythropoietin on the gene expression of Xenopus tropicalis peripheral blood cells. |
|
Relations |
BioSample |
SAMN39083358 |
SRA |
SRX23007695 |