|
| Status |
Public on May 30, 2024 |
| Title |
K562, SSRP1-dTAG, 5cap-seq, dTAG7, rep1, 1h |
| Sample type |
SRA |
| |
|
| Source name |
genome edited K562
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: genome edited K562
cell type: chronic myelogenous leukemia
genotype: SSRP1 N-terminal dTAG
treatment: dTAG7 1h
|
| Treatment protocol |
25 million cells per biological replicate were treated with dATG7 or DMSO for 1 h or 4 h. Next we spiked the samples D.melanogaster S2 cells (1:10) and performed subcellular fractionation as for mNET-seq. The chromatin pellets were treated with DNase I for 10 min before lysis in Qiazol (Qiagen).
|
| Growth protocol |
Cells were subcultured in RPMI medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 1x GlutaMax (Thermo Fisher Scientific) and maintained at densities between 1.5x105 and 7x105 cells/ml
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted according to manufacturer's protocol. 5 μg of RNA was treated with 5 U of Turbo DNase (Ambion) for 20 min at 37 ºC. The RNA samples were then treated with 1 U of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) for 60 min at 30 °C and purified by phenol:choroform:IAA extraction. rRNA-depleted RNA was treated with 30 U of quick CIP (NEB) for 30 min at 37 ºC and purified by double-phenol extraction and phenol:choroform:IAA extraction. CIP-treated RNA was then incubated with 5 U of Cap-CLIP acid pyrophosphatase (Cellscript) for 60 min at 37 ºC. Decapped-RNA samples were then purified by phenol:choroform:IAA extraction and ligated overnight at 16 ºC with an RNA adapter (10 μM) containing an 8-mer molecular barcode (UMI), 1 μl of T4 RNA ligase 1 and ATP (1 mM) for ligation to the 5’ ends of RNA. The following day, the samples were purified with 2X volume of RNAclean XP beads (Beckman Coulter) according to the manufacturer’s instructions followed by RNA fragmentation with NEBNext Magnesium RNA Fragmentation Module (NEB) for 5 min at 80 ºC, and immediately transferred on ice. Fragmented samples were purified with 3.5X volume of RNAclean XP beads and then incubated with random hexamers (Invitrogen) and dNTPs for 5 min at 65 °C, followed by incubation on ice. The RNA was reverse transcribed with Superscript II (Invitrogen) (25 °C for 10 min, 42 °C for 50 minutes, inactivation at 70 °C for 15 minutes). cDNA samples were purified with Ampure XP beads (Beckman Coulter). cDNA second-strand was synthesized with 0.5 μL of 5 μM biotinylated primer and Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) (1 min at 98 ºC, 2 min at 50 ºC and 15 min at 72 ºC), followed by purification using Ampure XP beads.
For library preparation the biotinylated samples were captured with 20 mL of streptavidin-coupled Dynabeads M-280 (Invitro- gen) by incubation for 30 min at room temperature on a rotating wheel. Double-stranded cDNA fragments were end-repaired with End Repair Enzyme Mix (NEB), dA-tailed with 7.5 U of Klenow Fragment (Thermo Scientific) and ligated to 0.5 mL of 2.5 mM paired-end sequencing adapters containing a multiplexing barcode with 800 U of T4 DNA ligase (New England BioLabs) for 2 hours at room temperature. Beads with bound cDNA were washed between each enzymatic reaction with wash buffer (5 mM Tris pH 7.5, 0.5 mM EDTA pH 8 and 1 M NaCl) with extra washes after ligation of the Illumina adaptor. The sample-bound beads were used for PCR amplification with 0.5 mL of 10 mM Illumina Paired-End primers and Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) with the following conditions: 30 s at 98_x0014_C for initial denaturation, followed by 10 cycles of 30 s at 98_x0014_C, 30 s at 65_x0014_C, 30 s at 72_x0014_C, and a final extension for 5 min at 72_x0014_C. The libraries were then purified using Ampure XP beads and analyzed with the Fragment Analyzer (NGS kit). Followed by pooling before size-selection with Ampure XP beads to enrich for fragments between 200 and 700 bp. The NGS libraries were sequenced on the Illumina NextSeq550 to generate 75-bp single- end reads.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
The 5cap-seq reads were first trimmed of the UMI (first 8 nt of the reads) with UMI-tools and then trimmed with Cutadapt {Martin, 2011 #416} with options: -f fastq -q 30 -m 25 -O 13 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC followed by mapping to the human genome version GRCh38 merged with the D. melanogaster genome version Dm6 with the STAR mapper with options: --runThreadN 24 --readFilesCommand zcat --outFilterType BySJout --outFilterMultimapNmax 1 --alignEndsType Extend5pOfRead1 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.05 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000 --outSAMtype BAM SortedByCoordinate. We next deduplicated the mapped data with UMI-tools to remove any PCR duplicates based on the UMI sequences. We then identified the first transcribed base (5’ end of the RNA) and used only this position in downstream analyses. The spike-in reads (processed as above) that mapped to the D. melanogaster genome were too low to be used for robust normalization, so we used reads mapping to human genes to obtain normalization factors to correct for sequencing depth and therefore refrain from performing expression change analyses for this dataset.
Assembly: GRCh38
Supplementary files format and content: bigwig
Library strategy: 5cap-seq
|
| |
|
| Submission date |
Sep 05, 2023 |
| Last update date |
May 30, 2024 |
| Contact name |
Kristina Žumer |
| E-mail(s) |
kristina.zumer@mpinat.mpg.de
|
| Organization name |
Max Planck Institute for Multidisciplinary Sciences
|
| Department |
Department of Molecular Biology
|
| Lab |
Cramer Laboratory
|
| Street address |
Am Faßberg 11
|
| City |
Göttingen |
| ZIP/Postal code |
37077 |
| Country |
Germany |
| |
|
| Platform ID |
GPL21697 |
| Series (2) |
| GSE242378 |
FACT orchestrates the interplay between chromatin structure and transcription [5Cap-Seq] |
| GSE242380 |
FACT orchestrates the interplay between chromatin structure and transcription |
|
| Relations |
| BioSample |
SAMN37284404 |
| SRA |
SRX21636886 |
