NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7663288 Query DataSets for GSM7663288
Status Public on Sep 13, 2023
Title CT_FLT-BuOE_rep3
Sample type SRA
 
Source name Cortex
Organism Mus musculus
Characteristics strain: C57BL/6
Sex: male
tissue: Cortex
treatment: spaceflight
treatment: BuOE
slide id: FLT_TX_2
roi number: 012
segment type: Full
area: 144580
nuclei_counts: 416
roi x coordinate: 11456
roi y coordinate: 45641
rawreads: 22102444
alignedreads: 21026215
deduplicatedreads: 916917
trimmedreads: 21998703
stitchedreads: 21575450
sequencingsaturation: 95.6
Treatment protocol Mice were launched at the Kennedy Space Center (KSC) and spent 35 days aboard the international space station (ISS). All mice were maintained at an ambient temperature of 26–28 °C with a 12-hour light/dark cycle during the flight. All mice were provided NASA Nutrient-upgraded Rodent Food Bar (NuRFB) and autoclaved deionized water ad libitum. MnTnBuOE-2-PyP5+ (BuOE) at 1 mg/kg (0.2 mL) was administrated subcutaneously 7 days prior to the flight launch and weekly aboard the ISS. All mice were subdivided into saline or BuOE treated groups. Upon return to the Earth, spaceflight mice were transported to the research laboratory at Roskamp Institute, Sarasota, Florida within 20 hours of splashdown. Mice were exsanguinated by closed-cardiac blood collection under deep Ketamine/Xylazine (150/45 mg/kg) anesthesia, followed by cervical dislocation as a secondary euthanasia method to ensure death. Ground control mice were maintained on Earth for 35 days in flight hardware cages under similar environmental conditions as the flight groups, including the same food, light/dark, temperature, treatment (SAL or BuOE), and euthanasia regimens. The protocol for GC mice commenced three days subsequent to the commencement of the protocol for spaceflight mice.
Growth protocol Ten-week-old C57BL/6 male mice.
Extracted molecule total RNA
Extraction protocol After sacrifice, mouse brains were then removed and prepared as follows. The left hemibrains were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 24 hours and then rinsed and washed with PBS for immunohistochemistry (IHC) assays or spatial genomics profiling. The right brains were flash-frozen and stored at −80 °C for further analysis. The study was approved by the Institutional Animal Care and Use Committee (IACUC) of Loma Linda University (LLU), Roskamp Institute, and The National Aeronautics and Space Administration (NASA).
Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina NovaSeq 6000
 
Description DSP-1001460001002-B-B01
Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
Data processing dcc-metadata = true
save-interim-files = false
quality-trim-score = 20
2color-trimming = True
adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
adapter-trim-match-length = 10
adapter-trim-max-mismatch = 3
barcode-max-mismatch = 1
stitching-max-mismatch = 2
dedup-hd = 1
threads = 4
Assembly: NA
Supplementary files format and content: Digital count conversion (DCC) files produced by Nanostring's GeoMx NGS pipeline
Supplementary files format and content: Files ending in "GeneExpression_Q3norm.txt" give Q3-normalized gene expression of the indicated brain region. TX=BuOE treatment; SAL=Saline treatment; FLT=spaceflight mice; GC=Grounded Control mice.
Supplementary files format and content: Files ending in "DEanalysis.txt" are thre results of the differential expression analysis output by the GeoMx DSP Control Center. GCvsFLT-SAL=GC-SAL vs. FLT-SAL; SALvsBuOE-FLT=FLT-BuOE vs. FLT-SAL; SALvsBuOE-GC=GC-BuOE vs. GS-SAL; BuOE=BuOE treatment; SAL=Saline treatment; FLT=spaceflight mice; GC=Grounded Control mice.
Library strategy: GeoMx-Seq
 
Submission date Jul 26, 2023
Last update date Sep 13, 2023
Contact name Isaac Jacob Kremsky
E-mail(s) ikremsky@llu.edu
Phone 4044368914
Organization name Loma Linda University
Department Basic Sciences
Street address 11175 Campus St., Chan Shun Pavilion, Room A1022
City Loma Linda
State/province CA
ZIP/Postal code 92350
Country USA
 
Platform ID GPL24247
Series (1)
GSE239336 Spaceflight-induced gene expression profiles in the mouse brain are attenuated by treatment with the antioxidant BuOE
Relations
BioSample SAMN36716324
SRA SRX21164717

Supplementary file Size Download File type/resource
GSM7663288_DSP-1001460001002-B-B01.dcc.gz 68.5 Kb (ftp)(http) DCC
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap